추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCTACGAGTGTGCCTGTGAGCCGGGCTACACAGGGAGCATGTGTAACATCAACATCGATGAGTGTGCGGGCAACCCCTGCCACAACGGGGGCACCTGCGAGGACGGCATCAATGGCTTCACCTGCCGCTGCCCCGAGGGCTACCACGACCCCACCTGCCTGTCTGAGGTCAATGAGTGCAACAGCAACCCCTGCGTCCACGGGGCCTGCCGGGACAGCCTCAACGGGTACAAGTGCGACTGTGACCCTGGGTGGAGTGGGACCAACTGTGACATCAACAACAATGAGTGTGAATCCAACCCTTGTGTCAACGGCGGCACCTGCAAAGACATGACCAGTGGCTACGTGTGCACCTGCCGGGAGGGCTTCAGCGGTCCCAACTGCCAGACCAACATCAACGAGTGTGCGTCCAACCCATGTCTGAACCAGGGCACGTGTATTGACGACGTTGCCGGGTACAAGTGCAACTGCCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NOTCH1(4851) , NOTCH1(4851)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Keqiang Zhang et al.
The American journal of pathology, 188(1), 242-251 (2017-10-19)
Flap endonuclease 1 (FEN1) plays a crucial role in both DNA replication and damage repair. In this study, FEN1 expression and its clinical-pathologic significance in non-small-cell lung cancer (NSCLC) was investigated. Quantitative RT-PCR and immunohistochemistry analysis identified that both FEN1
Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though
Debarshi Banerjee et al.
Cancer research, 75(8), 1592-1602 (2015-03-07)
The Notch pathway plays multiple key roles in tumorigenesis, and its signaling components have therefore aroused great interest as targets for emerging therapies. Here, we show that inhibition of Notch, using a soluble receptor Notch1 decoy, unexpectedly caused a remarkable
Yinan Liu et al.
PloS one, 9(10), e109588-e109588 (2014-10-15)
The Notch signaling pathway plays versatile roles during heart development. However, there is contradictory evidence that Notch pathway either facilitates or impairs cardiomyogenesis in vitro. In this study, we developed iPSCs by reprogramming of murine fibroblasts with GFP expression governed
Guanqiao Wang et al.
Cellular signalling, 27(7), 1369-1379 (2015-04-07)
Carbonic anhydrase IX(CA9)is a member of the carbonic anhydrase family that catalyzes the reversible hydration of carbon dioxide, and plays a key role in the regulation of pH. Although a large number of studies have shown that CA9 is strongly
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.