콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU147971

Sigma-Aldrich

MISSION® esiRNA

targeting human MIF

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CAGTGGTGTCCGAGAAGTCAGGCACGTAGCTCAGCGGCGGCCGCGGCGCGTGCGTCTGTGCCTCTGCGCGGGTCTCCTGGTCCTTCTGCCATCATGCCGATGTTCATCGTAAACACCAACGTGCCCCGCGCCTCCGTGCCGGACGGGTTCCTCTCCGAGCTCACCCAGCAGCTGGCGCAGGCCACCGGCAAGCCCCCCCAGTACATCGCGGTGCACGTGGTCCCGGACCAGCTCATGGCCTTCGGCGGCTCCAGCGAGCCGTGCGCGCTCTGCAGCCTGCACAGCATCGGCAAGATCGGCGGCGCGCAGAACCGCTCCTACAGCAAGCTGCTGTGCGGCCTGCTGGCCGAGCGCCTGCGCATCAGCCCGGACAGGGTCTACATCAACTATTACGACATGAACGCGGCCAATGTGGGCTGGAACAACTC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yu Zhang et al.
Clinical and experimental pharmacology & physiology, 43(11), 1134-1144 (2016-10-21)
Macrophage migration inhibitory factor (MIF), a pleiotropic pro-inflammatory cytokine, is a key regulator in both innate and acquired immunity systems. MIF has become a promising drug target for inflammatory diseases. Apart from its cytokine activities, MIF is known to act
Mei Zhang et al.
Molecular carcinogenesis, 58(6), 898-912 (2019-01-23)
Macrophage migration inhibitory factor (MIF) is a prominent orchestrator during the onset and progression of cancer. Recently, MIF was detected in salivary adenoid cystic carcinoma (SACC). However, its functional effect in perineural invasion (PNI) of SACC remained unknown. To illuminate
Mi Jeong Kim et al.
Cellular signalling, 34, 110-120 (2017-03-23)
The nuclear factor kappa B (NF-κB) pathway is pivotal in controlling survival and apoptosis of cancer cells. Macrophage migration inhibitory factor (MIF), a cytokine that regulates the immune response and tumorigenesis under inflammatory conditions, is upregulated in various tumors. However
Huihua Yuan et al.
Acta biomaterialia, 42, 247-257 (2016-07-03)
Stiffness of biomaterial substrates plays a critical role in regulation of cell behavior. Although the effect of substrate stiffness on cell behavior has been extensively studied, molecular mechanisms of regulation rather than those involving cytoskeletal activities still remain elusive. In
Jie Zeng et al.
Molecular medicine reports, 13(1), 174-180 (2015-11-10)
Macrophage migration inhibitory factor (MIF) is closely associated with tumorigenesis. The present study aimed to investigate the effects of MIF on the proliferation, migration and colony formation of oral squamous cell carcinoma (OSCC), and to quantify the protein expression levels

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.