콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU133631

Sigma-Aldrich

MISSION® esiRNA

targeting human ITCH

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACCTGCCACCATACAAGAGCTATGAGCAACTGAAGGAAAAGCTGTTGTTTGCCATAGAAGAAACAGAAGGATTTGGACAAGAGTAACTTCTGAGAACTTGCACCATGAATGGGCAAGAACTTATTTGCAATGTTTGTCCTTCTCTGCCTGTTGCACATCTTGTAAAATTGGACAATGGCTCTTTAGAGAGTTATCTGAGTGTAAGTAAATTAATGTTCTCATTTAGATTTATCTCCCAGTGATTTCTACTCAGCGTTTCCAGAAATCAGGTCTGCAAATGACTAGTCAGAACCTTGCTTAACATGAGATTTTAACACAACAATGAAATTTGCCTTGTCTTATTCCACTAGTTTATTCCTTTAACAACAATATTTTATGTGTGTCAAAAGTCTCACTTGGGAGTAGTGTTTTTTTCTTTTAGACATTCTGCAGACATGCAGGGAAGTCCTTTG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yoichiro Otaki et al.
Journal of the American Heart Association, 5(1) (2016-01-23)
The homologous to the E6-AP carboxyl terminus (HECT)-type ubiquitin E3 ligase ITCH is an enzyme that plays a pivotal role in posttranslational modification by ubiquitin proteasomal protein degradation. Thioredoxin-interacting protein (TXNIP) is a negative regulator of the thioredoxin system and
Lufen Chang et al.
Nucleic acids research, 47(2), 824-842 (2018-12-06)
The downregulation of the DNA damage response (DDR) enables aggressive tumors to achieve uncontrolled proliferation against replication stress, but the mechanisms underlying this process in tumors are relatively complex. Here, we demonstrate a mechanism through which a distinct E3 ubiquitin
Ji-Yeon Park et al.
Biochemical and biophysical research communications, 470(2), 336-342 (2016-01-23)
This study aimed to investigate the roles of autophagy and the ubiquitin-proteasome system in the degradation of histone deacetylase 8 (HDAC8) and to clarify the mechanism by which cAMP signaling regulates this degradation. cAMP signaling was activated by treating H1299

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.