추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTGGCCGTTATATCCAGGAGCTTCGGAGTATGATCAGATTCGGTATATTTCACAAACACAGGGTTTGCCTGCTGAATATTTATTAAGCGCCGGGACAAAGACAACTAGGTTTTTCAACCGTGACACGGACTCACCATATCCTTTGTGGAGACTGAAGACACCAGATGACCATGAAGCAGAGACAGGGATTAAGTCAAAAGAAGCAAGAAAGTACATTTTCAACTGTTTAGATGATATGGCCCAGGTGAACATGACGACAGATTTGGAAGGGAGCGACATGTTGGTAGAAAAGGCTGACCGGCGGGAGTTCATTGACCTGTTGAAGAAGATGCTGACCATTGATGCTGACAAGAGAATCACTCCAATCGAAACCCTGAACCATCCCTTTGTCACCATGACACACTTACTCGATTTTCCCCACAGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... HIPK2(28996) , HIPK2(28996)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Yi-Xuan Zhao et al.
Annals of plastic surgery, 79(6), 546-551 (2017-10-21)
Epithelial-mesenchymal transition (EMT) plays a critical role in fibrotic keloid formation, which is characterized by excessive collagen and extracellular matrix synthesis and deposition. Growing evidence suggests that the serine/threonine kinase homeodomain-interacting protein kinase 2 (HIPK2) acts upstream of several major
Zhengyu Jiang et al.
Cell death & disease, 9(9), 847-847 (2018-08-30)
Sepsis is the leading cause of death in intensive care units worldwide. Autophagy has recently been shown to protect against sepsis-induced liver injury. Here, we investigated the roles of homeodomain-interacting protein kinase 2 (HIPK2) in the molecular mechanism of sepsis-induced
Luyang Xu et al.
Theranostics, 9(9), 2712-2726 (2019-05-28)
The molecular mechanism underlying the transition of acute kidney injury (AKI) to chronic kidney disease (CKD) induced by vancomycin (VAN) remains largely unknown. Methods: The mice model of VAN drives AKI to CKD was developed to investigate the role and
Xiaoyan Dang et al.
Chemico-biological interactions, 316, 108922-108922 (2019-12-15)
Homeodomain interacting protein kinase-2 (HIPK2) has emerged as a crucial stress-responsive kinase that plays a critical role in regulating cell survival and apoptosis. However, whether HIPK2 participates in regulating cardiomyocyte survival during myocardial ischemia/reperfusion injury remains unclear. Here, we investigated
Xianhui Wen et al.
Experimental and therapeutic medicine, 21(4), 355-355 (2021-03-19)
Currently, bone marrow transplantation remains the basic treatment for various hematological tumors and irradiation is one of the most important pretreatment methods. However, irradiation pretreatment may result in damage to bone mesenchymal stem cells (BMSCs). The present study aimed to
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.