콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU135251

Sigma-Aldrich

MISSION® esiRNA

targeting human HIPK2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TTGGCCGTTATATCCAGGAGCTTCGGAGTATGATCAGATTCGGTATATTTCACAAACACAGGGTTTGCCTGCTGAATATTTATTAAGCGCCGGGACAAAGACAACTAGGTTTTTCAACCGTGACACGGACTCACCATATCCTTTGTGGAGACTGAAGACACCAGATGACCATGAAGCAGAGACAGGGATTAAGTCAAAAGAAGCAAGAAAGTACATTTTCAACTGTTTAGATGATATGGCCCAGGTGAACATGACGACAGATTTGGAAGGGAGCGACATGTTGGTAGAAAAGGCTGACCGGCGGGAGTTCATTGACCTGTTGAAGAAGATGCTGACCATTGATGCTGACAAGAGAATCACTCCAATCGAAACCCTGAACCATCCCTTTGTCACCATGACACACTTACTCGATTTTCCCCACAGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yi-Xuan Zhao et al.
Annals of plastic surgery, 79(6), 546-551 (2017-10-21)
Epithelial-mesenchymal transition (EMT) plays a critical role in fibrotic keloid formation, which is characterized by excessive collagen and extracellular matrix synthesis and deposition. Growing evidence suggests that the serine/threonine kinase homeodomain-interacting protein kinase 2 (HIPK2) acts upstream of several major
Zhengyu Jiang et al.
Cell death & disease, 9(9), 847-847 (2018-08-30)
Sepsis is the leading cause of death in intensive care units worldwide. Autophagy has recently been shown to protect against sepsis-induced liver injury. Here, we investigated the roles of homeodomain-interacting protein kinase 2 (HIPK2) in the molecular mechanism of sepsis-induced
Luyang Xu et al.
Theranostics, 9(9), 2712-2726 (2019-05-28)
The molecular mechanism underlying the transition of acute kidney injury (AKI) to chronic kidney disease (CKD) induced by vancomycin (VAN) remains largely unknown. Methods: The mice model of VAN drives AKI to CKD was developed to investigate the role and
Xiaoyan Dang et al.
Chemico-biological interactions, 316, 108922-108922 (2019-12-15)
Homeodomain interacting protein kinase-2 (HIPK2) has emerged as a crucial stress-responsive kinase that plays a critical role in regulating cell survival and apoptosis. However, whether HIPK2 participates in regulating cardiomyocyte survival during myocardial ischemia/reperfusion injury remains unclear. Here, we investigated
Xianhui Wen et al.
Experimental and therapeutic medicine, 21(4), 355-355 (2021-03-19)
Currently, bone marrow transplantation remains the basic treatment for various hematological tumors and irradiation is one of the most important pretreatment methods. However, irradiation pretreatment may result in damage to bone mesenchymal stem cells (BMSCs). The present study aimed to

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.