추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCCTGTACTGGACCACACCTTCTGCGTGGAACACAACGCCTTCGGGCGGATCCTGCAGCATGAACTGAAACCCAATGGCAGAAATGTGCCAGTCACAGAGGAGAATAAGAAAGAATACGTCCGGTTGTATGTAAACTGGAGGTTTATGAGAGGAATCGAAGCCCAGTTCTTAGCTCTGCAGAAGGGGTTCAATGAGCTCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SMURF1(57154) , SMURF1(57154)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
K Koefoed et al.
Scientific reports, 8(1), 9542-9542 (2018-06-24)
Smad ubiquitin regulatory factor 1 (SMURF1) is a HECT-type E3 ubiquitin ligase that plays a critical role in vertebrate development by regulating planar cell polarity (PCP) signaling and convergent extension (CE). Here we show that SMURF1 is involved in mammalian
Youmao Tao et al.
Oncology reports, 38(3), 1806-1814 (2017-07-22)
Smad ubiquitin regulatory factor 1 (SMURF1), a well-known E3 ubiquitin ligase, targets substrate proteins for ubiquitination and proteasomal degradation. Accumulating studies have shown that SMURF1 acts as an oncogenic factor in human malignancies. However, the clinical significance of SMURF1 and its
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.