콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU124431

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXM1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGCCCAGCAGTCTCTTACCTTCCCTGATCTTTGCAGGGTGGTCCGTGTAAATAGTATAAATTCTCCAAATTATCCTCTAATTATAAATGTAAGCTTATTTCCTTAGATCATTATCCAGAGACTGCCAGAAGGTGGGTAGGATGACCTGGGGTTTCAATTGACTTCTGTTCCTTGCTTTTAGTTTTGATAGAAGGGAAGACCTGCAGTGCACGGTTTCTTCCAGGCTGAGGTACCTGGATCTTGGGTTCTTCACTGCAGGGACCCAGACAAGTGGATCTGCTTGCCAGAGTCCTTTTTGCCCCTCCCTGCCACCTCCCCGTGTTTCCAAGTCAGCTTTCCTGCAAGAAGAAATCCTGGTTAAAAAAGTCTTTTGTATTGGGTCAGGAGTTGAATTTGGGGTGGGAGGATGGATGCAACTGAAGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Paweena Dana et al.
Cellular oncology (Dordrecht), 43(2), 211-222 (2019-11-16)
Cholangiocarcinoma (CCA) is an aggressive type of cancer. The major obstacles for treatment are its late presentation and the occurrence metastases. Targeting the metastatic process may serve as a treatment option. CD147 is a membrane protein that promotes CCA metastasis.
Qiyan Hu et al.
Oncology letters, 15(6), 10063-10069 (2018-06-22)
Cervical cancer is the second most common type of cancer in females worldwide. It has been demonstrated that microRNAs (miRs) serve important roles in the occurrence and development of various types of cancer, including cervical cancer. The results of the
Ying Z Mazzu et al.
Molecular oncology, 13(9), 1944-1958 (2019-06-22)
Epigenetic silencing of miRNA is a primary mechanism of aberrant miRNA expression in cancer, and hypermethylation of miRNA promoters has been reported to contribute to prostate cancer initiation and progression. Recent data have shown that the miR-193b promoter is hypermethylated
Monica Chang-Panesso et al.
The Journal of clinical investigation, 129(12), 5501-5517 (2019-11-12)
The proximal tubule has a remarkable capacity for repair after acute injury, but the cellular lineage and molecular mechanisms underlying this repair response are incompletely understood. Here, we developed a Kim1-GFPCreERt2 knockin mouse line (Kim1-GCE) in order to perform genetic
Nien-Tsu Hsieh et al.
Journal of cellular physiology, 234(7), 11265-11275 (2018-12-01)
Non-small-cell lung cancer (NSCLC) accounts for the majority of the lung cancer cases that have become a leading cause of cancer deaths worldwide. Overexpression of transcription factor forkhead box M1 (FOXM1) is involved in the inauspicious development of several types

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.