추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGCGTTAAGCAGGAACTGGAAGAGAAGGAGAATTGTCACCTGGAGCAGAATCGGGTTAAGGTTGAGGAGCCCTCAGGAGTGTCAACATCTTGGCAGGACTCTGTGTCTGAGAGGCCACCCTACTCTTATATGGCCATGATACAGTTTGCCATCAACAGCACTGAGAGAAAGCGCATGACCTTGAAGGACATCTACACTTGGATTGAGGACCACTTCCCTTACTTTAAGCACATTGCCAAGCCAGGCTGGAAGAACTCTATTCGTCACAACCTTTCTCTCCATGACATGTTTGTTCGAGAGACATCTGCCAATGGCAAGGTCTCCTTCTGGACCATTCACCCAAGTGCCAATCGCTACTTGACATTGGACCAAGTGTTTAAGCCACTGGAACCAGGGTCTCCACAATCGCCCGAGCACTTGGAATCACAGCA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... FOXM1(14235) , Foxm1(14235)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Xiaoxiao Li et al.
Journal of translational medicine, 11, 204-204 (2013-09-06)
Forkhead box transcription factor 1 (FOXM1) has been reported to overexpress and correlate with pathogenesis in a variety of human malignancies. However, little research has been done to investigate its clinical significance in gastric cancer. We examined the expression of
KanKan Yang et al.
Journal of experimental & clinical cancer research : CR, 34, 40-40 (2015-05-04)
The Forkhead box M1 (FOXM1) is an oncogenic transcription factor and plays a significant role in cell EMT, proliferation, metastasis in a multitude of human solid tumors including colorectal cancer (CRC). However, the underlying molecular mechanisms by which FoxM1 contributes
Jiujie Cui et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(10), 2595-2606 (2014-03-19)
The transcription factor Forkhead box protein M1 (FOXM1) plays critical roles in cancer development and progression. However, the regulatory role and underlying mechanisms of FOXM1 in cancer metabolism are unknown. In this study, we characterized the regulation of aerobic glycolysis
Weihua Jiang et al.
International journal of clinical and experimental pathology, 8(6), 6756-6763 (2015-08-12)
The oncogenic transcription factor forkhead box protein M1 (FOXM1) plays critical roles in gastric cancer (GC) development and progression. However, the underlying mechanisms has not fully demonstrated. Lactate dehydrogenase A (LDHA) is widely overexpressed in a series of cancers and
Satoru Inoguchi et al.
FEBS letters, 588(17), 3170-3179 (2014-07-08)
Here, we found that microRNA-24-1 (miR-24-1) is significantly reduced in bladder cancer (BC) tissues, suggesting that it functions as a tumour suppressor. Restoration of mature miR-24-1 inhibits cancer cell proliferation and induces apoptosis. Forkhead box protein M1 (FOXM1) is a
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.