추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGCCTGTGATGGTGGAACTAGCAAGTGACTTCCTGGACAGAAACACACCAGTCTTTCGAGATGATGTTTGCTTTTTCCTTAGTCAATCAGGTGAGACAGCAGATACTTTGATGGGTCTTCGTTACTGTAAGGAGAGAGGAGCTTTAACTGTGGGGATCACAAACACAGTTGGCAGTTCCATATCACGGGAGACAGATTGTGGAGTTCATATTAATGCTGGTCCTGAGATTGGTGTGGCCAGTACAAAGGCTTATACCAGCCAGTTTGTATCCCTTGTGATGTTTGCCCTTATGATGTGTGATGATCGGATCTCCATGCAAGAAAGACGCAAAGAGATCATGCTTGGATTGAAACGGCTGCCTGATTTGATTAAGGAAGTACTGAGCATGGATGACGAAATTCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GFPT1(2673) , GFPT1(2673)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Nana Zhang et al.
Cell death & disease, 10(5), 343-343 (2019-04-26)
Cigarette smoking has been shown to be a carcinogenic factor in breast cancer. Nicotine (Nic), an active component of tobacco, has been found to induce epithelial-mesenchymal transition (EMT) in breast cancer cells. However, the alterations in protein O-GlcNAcylation in Nic-mediated
Yubo Liu et al.
Cell death & disease, 9(5), 485-485 (2018-05-01)
Chemoresistance has become a major obstacle to the success of cancer therapy, but the mechanisms underlying chemoresistance are not yet fully understood. O-GlcNAcylation is a post-translational modification that is regulated by the hexosamine biosynthetic pathway (HBP) and has an important
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.