추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GAAAACTGCAGGAAGCTCTGATGCATTATAAGGAGGCTATTCGAATCAGTCCTACCTTTGCTGATGCCTACTCTAATATGGGAAACACTCTAAAGGAGATGCAGGATGTTCAGGGAGCCTTGCAGTGTTATACGCGTGCCATCCAAATTAATCCTGCATTTGCAGATGCACATAGCAATCTGGCTTCCATTCATAAGGATTCAGGGAATATTCCAGAAGCCATAGCTTCTTACCGCACGGCTCTGAAACTTAAGCCTGATTTTCCTGATGCTTATTGTAACTTGGCTCATTGCCTGCAGATTGTCTGTGATTGGACAGACTATGATGAGCGAATGAAGAAGTTGGTCAGTATTGTGGCTGACCAGTTAGAGAAGAATAGGTTGCCTTCTGTGCATCCTCATCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Lan V Pham et al.
Oncotarget, 7(49), 80599-80611 (2016-10-08)
The hexosamine biosynthetic pathway (HBP) requires two key nutrients glucose and glutamine for O-linked N-acetylglucosamine (O-GlcNAc) cycling, a post-translational protein modification that adds GlcNAc to nuclear and cytoplasmic proteins. Increased GlcNAc has been linked to regulatory factors involved in cancer
Resistance to bortezomib in breast cancer cells that downregulate Bim through FOXA1 O-GlcNAcylation.
Yubo Liu et al.
Journal of cellular physiology, 234(10), 17527-17537 (2019-02-23)
Bortezomib (BTZ), a well-established proteasome inhibitor used in the clinical therapy, leads the modulation of several biological alterations and in turn induces apoptosis. Although clinical trials with BTZ have shown promising results for some types of cancers, but not for
Ewa Forma et al.
PloS one, 13(6), e0198351-e0198351 (2018-06-05)
Enhancer of zest homolog 2 (EZH2) is a histone methyltransferase which plays a crucial role in cancer progression by regulation of genes involved in cellular processes such as proliferation, invasion and self-renewal. Activity and biological function of EZH2 are regulated
Bing Zhang et al.
American journal of cancer research, 7(6), 1337-1349 (2017-07-04)
Abnormal cellular energetics has emerged as a hallmark of cancer cells. Deregulating aerobic glycolysis can alter multiple metabolic and signaling pathways in cancer cells, and trigger unlimited growth and proliferation. Accumulating evidence suggests that elevated levels of protein modification with
Juliana L Sacoman et al.
The Journal of biological chemistry, 292(11), 4499-4518 (2017-01-20)
O-Linked N-acetylglucosamine transferase (OGT) catalyzes O-GlcNAcylation of target proteins and regulates numerous biological processes. OGT is encoded by a single gene that yields nucleocytosolic and mitochondrial isoforms. To date, the role of the mitochondrial isoform of OGT (mOGT) remains largely
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.