콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU010021

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTACCTGTGCAATGCCTGTGGCCTCTACCACAAGATGAATGGGCAGAACCGACCACTCATCAAGCCCAAGCGAAGACTGTCGGCCGCCAGAAGAGCCGGCACCTGTTGTGCAAATTGTCAGACGACAACCACCACCTTATGGCGCCGAAACGCCAACGGGGACCCTGTCTGCAACGCCTGTGGCCTCTACTACAAGCTGCACAATGTTAACAGGCCACTGACCATGAAGAAGGAAGGGATCCAGACTCGGAACCGGAAGATGTCCAACAAGTCCAAGAAGAGCAAGAAAGGGGCGGAGTGCTTCGAGGAGCTGTCAAAGTGCATGCAGGAGAAGTCATCCCCCTTCAGTGCAGCTGCCCTGGCTGGACACATGGCACCTGTGGGCCACCTCCCGCCCTTCAGCCACTCCGGACACATCCTGCCCACTCCGACGCCCATCCACCCCTCCTCCAGCCTCTCCTTCGGCCACCCCCACCCGTCCAGCATGGTGACCGCCATGGGCTAGGGAACAGATGGACGTCGAGGAC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Carole-Anne Whigham et al.
Scientific reports, 9(1), 235-235 (2019-01-20)
Preeclampsia is a pregnancy complication associated with elevated placental secretion of anti-angiogenic factors, maternal endothelial dysfunction and organ injury. GATA2 is a transcription factor expressed in the endothelium which regulates vascular homeostasis by controlling transcription of genes and microRNAs, including
Siyan Chen et al.
Molecular immunology, 123, 32-39 (2020-05-16)
At present, most studies on the relationship between hepatitis B virus (HBV) and IL-33/ST2 axis focus on clinical detection, but the underlying molecular mechanisms of HBx and IL-33/ST2 axis regulation and Th cell function regulation have not been explored. In
Fuwen Yuan et al.
Nucleic acids research, 47(19), 10104-10114 (2019-09-11)
Enzalutamide, a second-generation androgen receptor (AR) antagonist, has demonstrated clinical benefit in men with prostate cancer. However, it only provides a temporary response and modest increase in survival, indicating a rapid evolution of resistance. Previous studies suggest that enzalutamide may
Cong Qiu et al.
Nature communications, 8, 15426-15426 (2017-06-02)
Data from clinical research and our previous study have suggested the potential involvement of SENP1, the major protease of post-translational SUMOylation, in cardiovascular disorders. Here, we investigate the role of SENP1-mediated SUMOylation in graft arteriosclerosis (GA), the major cause of
Mark A Gillespie et al.
Molecular cell, 78(5), 960-974 (2020-04-25)
Dynamic cellular processes such as differentiation are driven by changes in the abundances of transcription factors (TFs). However, despite years of studies, our knowledge about the protein copy number of TFs in the nucleus is limited. Here, by determining the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.