Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU140621

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTCAGTTGGGCCTTCATAAACACTCACCTGGCTGGCTTTGCCTTCCAGGAGGAAGCTGGCTGAAGCAAGGGTGTGGAATTTTAAATGTGTGCACAGTCTGGAAAACTGTCAGAATCAGTTTTCCCATAAAAGGGTGGGCTAGCATTGCAGCTGCATTTGGGACCATTCAAATCTGTCACTCTCTTGTGTATATTCCTGTGCTATTAAATATATCAGGGCAGTGCATGTAAATCATCCTGATATATTTAATATATTTATTATATTGTCCCCCGAGGTGGGGACAGTGAGTGAGTTCTCTTAGTCCCCCCAGAGCTGGTTGTTAAAGAGCCTGGCACCTACCCGCTCTCACTTCATCTGTGTCATCTCTGCACACTCCAGCCCACTTTCTGCCTTCAGCCAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kang Sun et al.
World journal of gastroenterology, 22(42), 9368-9377 (2016-11-30)
To investigate the role of interferon regulatory factor 5 (IRF5) in reversing polarization of lung macrophages during severe acute pancreatitis (SAP) A mouse SAP model was established by intraperitoneal (ip) injections of 20 μg/kg body weight caerulein. Pathological changes in
Hongbin Cai et al.
Biochemical and biophysical research communications, 492(2), 192-198 (2017-08-19)
Ischemia-reperfusion injury (IRI) has been implicated in many pathological conditions, including cardiovascular diseases. Adhesion of leukocytes to the surface of endothelial cells has been considered as one of the principle steps in the pathological cascade of inflammatory tissue damage during
Jihyun Yang et al.
Journal of cellular physiology, 234(12), 23033-23042 (2019-05-28)
Bone-resorbing osteoclasts are differentiated from macrophages (MΦ) by M-CSF and RANKL. MΦ can be mainly classified into M1 and M2 MΦ, which are proinflammatory and anti-inflammatory, respectively, but little is known about their osteoclastogenic potential. Here, we investigated the osteoclastogenic
Ratana Lim et al.
Reproduction (Cambridge, England), 156(3), 207-218 (2018-07-15)
Preterm birth continues to be the leading cause of neonatal mortality and morbidities that can extend into adult life. Few treatment options stem from our incomplete understanding of the mechanisms of human labour and delivery. Activation of the inflammatory response
Matija Hedl et al.
Journal of immunology (Baltimore, Md. : 1950), 202(3), 920-930 (2018-12-30)
Common IFN regulatory factor 5 (IRF5) variants associated with multiple immune-mediated diseases are a major determinant of interindividual variability in pattern recognition receptor (PRR)-induced cytokines in macrophages. PRR-initiated pathways also contribute to bacterial clearance, and dysregulation of bacterial clearance can

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique