Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU081301

Sigma-Aldrich

MISSION® esiRNA

targeting human RACGAP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGGTCATTGTTGGGAGCTTTTAGATGAGACATCTTTCCAGGGGTAGAAGGGTTAGTATGGAATTGGTTGTGATTCTTTTTGGGGAAGGGGGTTATTGTTCCTTTGGCTTAAAGCCAAATGCTGCTCATAGAATGATCTTTCTCTAGTTTCATTTAGAACTGATTTCCGTGAGACAATGACAGAAACCCTACCTATCTGATAAGATTAGCTTGTCTCAGGGTGGGAAGTGGGAGGGCAGGGCAAAGAAAGGATTAGACCAGAGGATTTAGGATGCCTCCTTCTAAGAACCAGAAGTTCTCATTCCCCATTATGAACTGAGCTATAATATGGAGCTTTCATAAAAATGGGATGCATTGAGGACAGAACTAGTGATGGGAGTATGCGTAGCTTTGATTTGGATGATTAGGTCTTTAATAGTGTTGAGTGGCACAACCTTG

Numéro d'accès Ensembl | humain

ENSG00000161800

Numéro d'accès NCBI

NM_013277

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... RACGAP1(29127) , RACGAP1(29127)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xinchun Ding et al.
Oncotarget, 8(18), 30123-30137 (2017-04-19)
Lysosomal acid lipase (LAL) is a critical neutral lipid metabolic enzyme that regulates metabolic reprogramming in myeloid-derived suppressor cells (MDSCs) through over-activation of mammalian target of rapamycin (mTOR). Affymetrix GeneChip microarray analysis of MDSCs from LAL deficient mouse (lal-/-) revealed
Matthew L Kutys et al.
Nature cell biology, 16(9), 909-917 (2014-08-26)
Rho-family GTPases govern distinct types of cell migration on different extracellular matrix proteins in tissue culture or three-dimensional (3D) matrices. We searched for mechanisms selectively regulating 3D cell migration in different matrix environments and discovered a form of Cdc42-RhoA crosstalk
Arjan J van Adrichem et al.
FEBS letters, 589(24 Pt B), 3859-3865 (2015-11-26)
Male germ cell Rac GTPase-activating protein (MgcRacGAP) is a core regulator of cytokinesis. Furthermore, it appears to be involved in human oncogenesis through cytokinesis-independent mechanisms and has been reported to be essential for nuclear translocation of signal transducer and activator
Toshiyuki Kawashima et al.
The Journal of cell biology, 175(6), 937-946 (2006-12-21)
STAT transcription factors are tyrosine phosphorylated upon cytokine stimulation and enter the nucleus to activate target genes. We show that Rac1 and a GTPase-activating protein, MgcRacGAP, bind directly to p-STAT5A and are required to promote its nuclear translocation. Using permeabilized

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique