Skip to Content
Merck
All Photos(1)

Key Documents

EHU064921

Sigma-Aldrich

MISSION® esiRNA

targeting human SPHK1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGGCAGGCATATGGAGTATGAATGCCCCTACTTGGTATATGTGCCCGTGGTCGCCTTCCGCTTGGAGCCCAAGGATGGGAAAGGTGTGTTTGCAGTGGATGGGGAATTGATGGTTAGCGAGGCCGTGCAGGGCCAGGTGCACCCAAACTACTTCTGGATGGTCAGCGGTTGCGTGGAGCCCCCGCCCAGCTGGAAGCCCCAGCAGATGCCACCGCCAGAAGAGCCCTTATGACCCCTGGGCCGCGCTGTGCCTTAGTGTCTACTTGCAGGACCCTTCCTCCTTCCCTAGGGCTGCAGGGCCTGTCCACAGCTCCTGTGGGGGTGGAGGAGACTCCTCTGGAGAAGGGTGAGAAGGTGGAGGCTATGCTTTGGGGGGACAGGCCAGAATGAAGTCCTGGGTCAGGAGCCCAGCTGGCTGGGCCCAGCTGCCTATGTAAGGCCTTCTAGTTTGTTCTGAGACCCCCA

Ensembl | human accession no.

ENSG00000176170

NCBI accession no.

NM_182965

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SPHK1(8877) , SPHK1(8877)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
PKU
HKU
KAS
RPR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Peter C Hart et al.
Molecular cancer research : MCR, 17(4), 870-881 (2019-01-19)
The role of phospholipid signaling in ovarian cancer is poorly understood. Sphingosine-1-phosphate (S1P) is a bioactive metabolite of sphingosine that has been associated with tumor progression through enhanced cell proliferation and motility. Similarly, sphingosine kinases (SPHK), which catalyze the formation
Wenhua Li et al.
Oncotarget, 7(49), 80586-80598 (2016-11-05)
Sphingosine kinase 1 (SPHK1) has been shown to be involved in the progression of various types of human cancers. We previously demonstrated that SPHK1 is overexpressed and associated with clinical stage, locoregional recurrence, distant metastasis and poor prognosis in nasopharyngeal
Satomi Igawa et al.
The Journal of investigative dermatology, 139(8), 1743-1752 (2019-02-27)
Sphingosine 1-phosphate (S1P) is a bioactive lipid mediator generated when a cell membrane or its components are damaged by various factors. S1P regulates diverse cell activities via S1P receptors (S1PRs). Keratinocytes express S1PR1-5. Although it is known that S1PRs control
Yujin Zhang et al.
The Journal of clinical investigation, 124(6), 2750-2761 (2014-05-20)
Sphingosine-1-phosphate (S1P) is a bioactive lipid that regulates multicellular functions through interactions with its receptors on cell surfaces. S1P is enriched and stored in erythrocytes; however, it is not clear whether alterations in S1P are involved in the prevalent and
Se Kyoo Jeong et al.
Journal of dermatological science, 79(3), 229-234 (2015-06-27)
The ceramide metabolite, sphingosine-1-phosphate (S1P), regulates multiple cellular functions in keratinocytes (KC). We recently discovered that production of a key innate immune element, cathelicidin antimicrobial peptide (CAMP), is stimulated via a NF-κB-dependent mechanism that is activated by S1P when S1P

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service