설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACTCACGGGTGTCAAAGAGGCCTCTGCACTGGACTTTGATGTGTCCAACAATCACATCTACTGGACTGATGTTAGCCTCAAGACGATCAGCCGAGCCTTCATGAATGGGAGCTCAGTGGAGCACGTGATTGAGTTTGGCCTCGACTACCCTGAAGGAATGGCTGTGGACTGGATGGGCAAGAACCTCTATTGGGCGGACACAGGGACCAACAGGATTGAGGTGGCCCGGCTGGATGGGCAGTTCCGGCAGGTGCTTGTGTGGAGAGACCTTGACAACCCCAGGTCTCTGGCTCTGGATCCTACTAAAGGCTACATCTACTGGACTGAGTGGGGTGGCAAGCCAAGGATTGTGCGGGCCTTCATGGATGGGACCAATTGTATGACACTGGTAGACAAGGTGGGCCGGGCCAACGACCTCACCATTGATTATGCCGACCAGCGACTGTACTGGACTGACCTGGACACCAACATG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... LRP5(16973) , Lrp5(16973)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Nellie Y Loh et al.
Cell metabolism, 21(2), 262-273 (2015-02-05)
Common variants in WNT pathway genes have been associated with bone mass and fat distribution, the latter predicting diabetes and cardiovascular disease risk. Rare mutations in the WNT co-receptors LRP5 and LRP6 are similarly associated with bone and cardiometabolic disorders.
Ioanna Papathanasiou et al.
Arthritis research & therapy, 14(2), R82-R82 (2012-04-20)
Events normally taking place in the terminal chondrocyte differentiation in the growth plate are also observed during osteoarthritis (OA) development, suggesting that molecules, such as Wnts and bone morphogenetic proteins (BMPs) regulating chondrocyte activity in the growth plate, may play
Jessica Svedlund et al.
Endocrine-related cancer, 21(2), 231-239 (2013-12-03)
Primary hyperparathyroidism (pHPT) resulting from parathyroid tumors is a common endocrine disorder with incompletely understood etiology. In renal failure, secondary hyperparathyroidism (sHPT) occurs with multiple tumor development as a result of calcium and vitamin D regulatory disturbance. The aim of
Luqi Zhang et al.
Neurochemistry international, 87, 13-21 (2015-05-12)
Emerging studies have suggested the involvement of dysregulated Wnt/β-catenin cascade in the etiology of Alzheimer's disease (AD). Recently, genetic variations in Wnt co-receptor low density lipoprotein receptor-related protein (LRP) 6 causing reduced Wnt signaling has been linked to late-onset AD.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.