설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CGAGGCAGCACATAGATGAACTCCGGGATAGTGACAGCGTCTGTGACAGTGGTGTGGAGACATCCTTCCGCAAACTCAGCTTTACAGAGTCTCTTACTGGAGACAGCCCACTGCTATCTCTGAACAAAATGCCCCACGGTTATGGGCAGGAAGGACCTATTGAAGGCAAAATTTAGCCTGCTGGCCGTTCCCCCACACTGTGTAAACCAAAGCCCTGACAGTCCATTGCATCGTCCCAAAGGAGGAAGGCAAAGCGAATCCAAAGGTGCTGGAGAATCGCCGGCCTGCAGGGTCACTCGATTTCATTCAAGGCCTTCCGAATTTGGCGTCCTTCTTGGTTCTGAAATGAAATGTAGTTGCCACGCACAGACGGTGTCTAGCAATCATGGCGCTCGCTCGCTCAGCTGCACTCTATGGCTCAGGTGCAGTG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... NFKB1(18033) , Nfkb1(18033)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
12 - Non Combustible Liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Tong Yuan et al.
The Journal of surgical research, 192(1), 150-162 (2014-06-24)
Lidocaine has been used as a local anesthetic with anti-inflammatory properties, but its effects on neuroinflammation have not been well defined. In the present study, we investigated the prophylactic effects of lidocaine on lipopolysaccharide (LPS)-activated microglia and explored the underlying
Role of ferulic acid in the amelioration of ionizing radiation induced inflammation: a murine model.
Ujjal Das et al.
PloS one, 9(5), e97599-e97599 (2014-05-24)
Ionizing radiation is responsible for oxidative stress by generating reactive oxygen species (ROS), which alters the cellular redox potential. This change activates several redox sensitive enzymes which are crucial in activating signaling pathways at molecular level and can lead to
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.