설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ATCTTGGTCAGCCTCAGTGCTGGACCAACAGGACAATGTCCTCTCGCTACAGCTCTGCACCCCAGCCAATGCTCCTATTGGCCTGTACCGTCTCAGCCTAGAGGCTTCTACTGGCTACCAGGGCTCCAGCTTTGTGCTGGGCCACTTCATCCTGCTCTACAATGCCTGGTGCCCAGCCGATGATGTGTACCTAGACTCAGAGGAGGAGCGACGGGAATATGTCCTTACGCAACAGGGCTTCATCTACCAAGGCTCTGTCAAGTTCATCAAGAGTGTGCCTTGGAACTTTGGGCAGTTCGAGGATGGAATCCTGGATACCTGCCTGATGCTCTTGGATATGAACCCCAAGTTCCTGAAGAACCGTAGTCGGGACTGCTCACGCCGCAGCAGTCCCATCTATGTGGG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... TGM2(21817) , Tgm2(21817)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Deborah T Leicht et al.
Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 9(6), 872-881 (2014-05-16)
Esophageal adenocarcinomas (EAC) are aggressive cancers that are increasing in incidence and associated with a poor prognosis. The identification of highly expressed genes in EAC relative to metaplastic Barrett's esophagus (BE) may provide new targets for novel early cancer detection
Ahmed A Ashour et al.
Journal of cellular and molecular medicine, 18(11), 2235-2251 (2014-09-13)
Pancreatic ductal adenocarcinoma is one of the lethal cancers with extensive local tumour invasion, metastasis, early systemic dissemination and poorest prognosis. Thus, understanding the mechanisms regulating invasion/metastasis and epithelial-mesenchymal transition (EMT), is the key for developing effective therapeutic strategies for
Kaiser M Bijli et al.
Shock (Augusta, Ga.), 42(6), 562-569 (2014-07-25)
We addressed the role of transglutaminase 2 (TG2), a calcium-dependent enzyme that catalyzes cross-linking of proteins, in the mechanism of endothelial cell (EC) inflammation and lung polymorphonuclear lymphocyte (PMN) infiltration. Exposure of EC to thrombin, a procoagulant and proinflammatory mediator
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.