콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU059571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cxcl16

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCCTGCACATAGTCAGAGCACTCAGCACTCCACTCTTCCATCAGGAGCACTGTCCTTAAACAAAGAGCACACCCAACCCTGGGAGATGACCACTCTCCCTTCAGGCTATGGTCTGGAAGCTAGGCCTGAGGCTGAGGCAAATGAGAAACAGCAAGATGACAGACAGCAAGAAGCACCAGGAGCTGGAGCTAGCACACCAGCTTGGGTACCGGTGCTGTCCCTCCTGGCCATTGTCTTCTTCCTCACTGCAGCCATGGCCTATGTGCTGTGCAACAGGAGAGCGACACAGCAGAACTCTGCAGGTTTGCAGCTCTGGTACACTCCTGTTGAACCAAGACCCTAGCGCCTACAGCAAGAGTGGAAGCTCATTAGAGATGGATGATGACATGGGAGAGGTGGT

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Audrey Dieudonné et al.
PloS one, 7(8), e41952-e41952 (2012-08-11)
Scavenger receptors and Toll-like receptors (TLRs) cooperate in response to danger signals to adjust the host immune response. The TLR3 agonist double stranded (ds)RNA is an efficient activator of innate signalling in bronchial epithelial cells. In this study, we aimed
Xu Chang Geng et al.
Molecular medicine reports, 11(5), 3860-3865 (2015-01-13)
Erythropoietin (EPO) is a hematopoietic hormone that protects against renal interstitial fibrosis in animal models; however, the mechanism underlying the anti‑fibrotic activity of EPO has remained elusive. The present study aimed to elucidate this mechanism. Twenty‑four male C57BL6 mice were

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.