콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU050191

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mmp14

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCTCCGAGGAGAGATGTTTGTCTTCAAGGAGCGATGGTTCTGGCGGGTGAGGAATAACCAAGTGATGGATGGATACCCAATGCCCATTGGCCAATTCTGGAGGGGCCTGCCTGCATCCATCAATACTGCCTACGAAAGGAAGGATGGCAAATTTGTCTTCTTCAAAGGAGATAAGCACTGGGTGTTTGACGAAGCCTCCCTGGAACCCGGGTACCCCAAGCACATTAAGGAGCTTGGCCGAGGGCTGCCCACGGACAAGATCGATGCAGCTCTCTTCTGGATGCCCAATGGGAAGACCTACTTCTTCCGGGGCAATAAGTACTACCGGTTCAATGAAGAATTCAGGGCAGTGGACAGCGAGTACCCTAAAAACATCAAAGTCTGGGAAGGAATCCCTGAATCTCCCAGGGGGTCATTCATGGGCAGTGATG

Ensembl | 마우스 수납 번호

ENSMUSG00000000957

NCBI 수납 번호

NM_008608

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... MMP14(17387) , Mmp14(17387)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Evelyne Tassone et al.
Journal of cellular physiology, 230(2), 366-377 (2014-07-06)
Membrane-type 1 matrix metalloproteinase (MT1-MMP, MMP-14), a transmembrane proteinase with an extracellular catalytic domain and a short cytoplasmic tail, degrades extracellular matrix components and controls diverse cell functions through proteolytic and non-proteolytic interactions with extracellular, intracellular, and transmembrane proteins. Here
Bi-Sen Ding et al.
Journal of cell science, 128(16), 2983-2988 (2015-06-28)
Human airway basal cells are the stem (or progenitor) population of the airway epithelium, and play a central role in anchoring the epithelium to the basement membrane. The anatomic position of basal cells allows for potential paracrine signaling between them
Naohiko Koshikawa et al.
Cancer research, 75(16), 3327-3339 (2015-07-02)
Eph receptor tyrosine kinases are considered candidate therapeutic targets in cancer, but they can exert opposing effects on cell growth. In the presence of its ligands, Eph receptor EphA2 suppresses signaling by other growth factor receptors, including ErbB, whereas ligand-independent
Dane K Lund et al.
American journal of physiology. Cell physiology, 307(2), C140-C149 (2014-06-06)
The twenty-five known matrix metalloproteases (MMPs) and their endogenous inhibitors, tissue inhibitors of metalloproteases (TIMPs), mediate cell invasion through the extracellular matrix (ECM). In a comparative three-dimensional assay, we analyzed human and mouse satellite cells' competence to invade an artificial

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.