콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU028841

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rac1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTCACACAGCGAGGACTCAAGACAGTGTTTGACGAAGCTATCCGAGCGGTTCTCTGTCCCCCTCCTGTCAAGAAGAGGAAGAGAAAATGCCTGCTGTTGTAAATGTCGGAGCCCCTCGTTCTCGGTCCTGCCTGGAACCTTTGTACGCTTTGCTCAAAAATCAGCGAGCCTTCGCATTTGATGCCAAGTTTTTGTTACAGATTAATTTTTCCATAAAACCATTTTGAACCAATGAACCAGTCAATAATTTTAAGGTTCTGTTTTAAATGTAAGAATTCCAACTTACAGTCTATTAAAATTCAGCCCTAAAATGACAAAGCCTTCTTAAAGCCTTATTTTTAAAATCCCCCATTCTTGCTCAGATTAAAAATTGCCAAAATACCTTCTGAACTAAGTTGCGTTGTGCTGAGAACACCTAAGCACTAAACTCTCTTGAGAGACTTCTGTTGCTAAGAAGACCGCAGC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hongxue Shi et al.
International journal of biological sciences, 11(7), 845-859 (2015-06-17)
Fibroblasts play a pivotal role in the process of cutaneous wound repair, whereas their migratory ability under diabetic conditions is markedly reduced. In this study, we investigated the effect of basic fibroblast growth factor (bFGF) on human dermal fibroblast migration
Laurent Pieuchot et al.
Nature communications, 9(1), 3995-3995 (2018-09-30)
Cells have evolved multiple mechanisms to apprehend and adapt finely to their environment. Here we report a new cellular ability, which we term "curvotaxis" that enables the cells to respond to cell-scale curvature variations, a ubiquitous trait of cellular biotopes.
S Skvortsov et al.
British journal of cancer, 110(11), 2677-2687 (2014-05-03)
In order to improve therapy for HNSCC patients, novel methods to predict and combat local and/or distant tumour relapses are urgently needed. This study has been dedicated to the hypothesis that Rac1, a Rho GTPase, is implicated in HNSCC insensitivity
Cuong Thach Nguyen et al.
Infection and immunity, 82(9), 3802-3810 (2014-07-02)
Caseinolytic protease L (ClpL) is a member of the HSP100/Clp chaperone family, which is found mainly in Gram-positive bacteria. ClpL is highly expressed during infection for refolding of stress-induced denatured proteins, some of which are important for adherence. However, the
Vianey Gonzalez-Villasana et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 21(9), 2127-2137 (2015-01-18)
Zoledronic acid is being increasingly recognized for its antitumor properties, but the underlying functions are not well understood. In this study, we hypothesized that zoledronic acid inhibits ovarian cancer angiogenesis preventing Rac1 activation. The biologic effects of zoledronic acid were

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.