콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU021961

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mapk14

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGAGTGGAAGAGCCTGACCTATGATGAAGTCATCAGCTTTGTGCCACCACCCCTTGACCAAGAAGAAATGGAGTCCTGAGCACCTGGTTTCTGTTCTGTCTATCTCACTTCACTGTGAGGGGAAGACCTTCTCATGGGAACTCTCCAAATACCATTCAAGTGCCTCTTGTTGAAAGATTCCTTCATGGTGGAAGGGGGTGCATGTATGTGTTAGTGTTTGTGTGTGTGTGTGTGTCTGTCTGTTCGTCTGTCCACCTATCTTTGTGGAAGTCACTGTGATGGTAGTGACTTTATGAGTTGTGAATGGTCCTTGGCAGTCTGCCTGCTTTCTCAGAGTCTGGGCAGGCCGATGGGAACTGTCATCTCCTTAGGGATGTGTGTGTTCAGTGCAAAGTAAGAAATATGAAAATATCCCTGTTCTTAGTTACCTTGCCACTTTGGCTTC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hye Jeong Lee et al.
Molecular endocrinology (Baltimore, Md.), 29(6), 873-881 (2015-04-01)
Irisin is a novel myokine produced by skeletal muscle. However, its metabolic role is poorly understood. In the present study, irisin induced glucose uptake in differentiated skeletal muscle cells. It increased AMP-activated protein kinase (AMPK) phosphorylation and the inhibition of
Ana M Tormos et al.
PloS one, 12(2), e0171738-e0171738 (2017-02-07)
Hepatocyte poliploidization is an age-dependent process, being cytokinesis failure the main mechanism of polyploid hepatocyte formation. Our aim was to study the role of p38α MAPK in the regulation of actin cytoskeleton and cytokinesis in hepatocytes during development and aging.
Xiaoling Gu et al.
Free radical biology & medicine, 83, 149-158 (2015-03-17)
An increasing number of studies have focused on the phenomenon that mitochondrial DNA (mtDNA) activates innate immunity responses. However, the specific role of mtDNA in inflammatory lung disease remains elusive. This study was designed to examine the proinflammatory effects of
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
Xi-Xi Lin et al.
Toxicology mechanisms and methods, 24(8), 575-583 (2014-08-20)
Cigarette smoke contains reactive oxygen (ROS) that can cause oxidative stress. It increases the number of apoptotic and necrotic lung cells and further induces the development of chronic airway disease. In this study, we investigated the effects of cigarette smoke

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.