추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGACACTGGGGGTAACATCGCTTTTTCCCAATCTCACAAATTTACAAACCCTCAGGATAGGAAATGTAGAGACTTTCAGTGAGATAAGGAGAATAGATTTTGCTGGGCTGACTTCTCTCAATGAACTTGAAATTAAGGCATTAAGTCTCCGGAATTATCAGTCCCAAAGTCTAAAGTCGATCCGCGACATCCATCACCTGACTCTTCACTTAAGCGAGTCTGCTTTCCTGCTGGAGATTTTTGCAGATATTCTGAGTTCTGTGAGATATTTAGAACTAAGAGATACTAACTTGGCCAGGTTCCAGTTTTCACCACTGCCCGTAGATGAAGTCAGCTCACCGATGAAGAAGCTGGCATTCCGAGGCTCGGTTCTCACTGATGAAAGCTTTAACGAGCTCCTGAAGCTGTTGCGTTACA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... TLR2(24088) , Tlr2(24088)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Seok-Seong Kang et al.
Cytokine, 75(1), 174-180 (2015-05-20)
Staphylococcus aureus can cause the intestinal inflammatory diseases. However, little is known about the molecular mechanism of S. aureus infection in the intestine. In the present study, we investigated whether S. aureus could stimulate human intestinal epithelial cells triggering inflammation.
Helge Haarmann et al.
Biochemical and biophysical research communications, 467(1), 46-52 (2015-09-30)
Bacterial colonisation with Moraxella catarrhalis may partly sustain chronic inflammation in the lower airways of patients with chronic obstructive pulmonary disease (COPD). In addition, this bacterium causes infectious exacerbations of COPD, which often necessitate treatment with antibiotics. Antimicrobial peptides are
Megumi Inomata et al.
PloS one, 13(8), e0202791-e0202791 (2018-08-29)
Porphyromonas gingivalis possesses various abilities to evade and disrupt host immune responses, by which it acts as an important periodontal pathogen. P. gingivalis produces outer membrane protein A (OmpA)-like proteins (OmpALPs), Pgm6 and Pgm7, as major O-linked glycoproteins, but their
Seung Heon Shin et al.
Allergy, asthma & immunology research, 8(1), 63-68 (2015-11-06)
Chronic rhinosinusitis with nasal polyps is a chronic inflammatory disease with markedly increased eosinophils, Th2-type lymphocytes, fibroblasts, and goblet cells. Fungi are commonly associated with airway inflammatory diseases, and thymic stromal lymphopoietin (TSLP) is important in the development of Th2
Min Li et al.
Biochemical and biophysical research communications, 466(4), 748-754 (2015-10-02)
Microphage apoptosis is a critical event in atherosclerotic lesions in patients with diabetes. In the present investigation, high glucose treatment inhibited Akt phosphorylation and activated caspase 3 in primary peritoneal macrophage, leading to cell apoptosis. Hypoxia prolonged macrophage survival in
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.