콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU005581

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Timp1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CGAATCAACGAGACCACCTTATACCAGCGTTATAAGATCAAGATGATGACTAAGATGCTAAAAGGATTCAAGGCTGTGGGAAATGCCGCAGATATCCGGTACGCCTACACCCCAGTCATGGAAAGCCTCTGTGGATATGCCCACAAGTCCCAGAACCGCAGTGAAGAGTTTCTCATCACGGGCCGCCTAAGGAACGGGAAATTTCACATCAATGCCTGCAGCTTCTTGGTTCCCTGGCGTACTCTGAGCCCTGCTCAGCAAAGAGTTTTCTCAAAAAAGAACTATAGTGCTGGCTGTGGGGTGTGCACAGTGTTTCCCTGTTTATCTATCCCTTGCAAACTGGAGAGTGACACTCACTGTTTGTGGACGGATCAGGTCCTCGTGGGCTCTGAGGACTACCAGAGCCGTC

Ensembl | 마우스 수납 번호

ENSMUSG00000001131

NCBI 수납 번호

NP_001037849

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... Timp1(21857)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xiujuan Yao et al.
Respirology (Carlton, Vic.), 20(5), 730-738 (2015-05-02)
Interleukin (IL)-25 has been implicated in the pathogenesis of human asthma by inducing a Th2 cytokine response, but its possible role in the development of airway remodelling is less clear. We developed a murine surrogate of chronic airway inflammation induced
Rosemarie Chirco D'Angelo et al.
Molecular cancer research : MCR, 12(9), 1324-1333 (2014-06-05)
Tissue inhibitor of metalloproteinase-1 (TIMP-1) regulates intracellular signaling networks for inhibition of apoptosis. Tetraspanin (CD63), a cell surface binding partner for TIMP-1, was previously shown to regulate integrin-mediated survival pathways in the human breast epithelial cell line MCF10A. In the
Robert Ramer et al.
Biochemical pharmacology, 91(2), 202-216 (2014-07-01)
Cannabinoids inhibit tumor neovascularization as part of their tumorregressive action. However, the underlying mechanism is still under debate. In the present study the impact of cannabinoids on potential tumor-to-endothelial cell communication conferring anti-angiogenesis was studied. Cellular behavior of human umbilical

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.