콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU158451

Sigma-Aldrich

MISSION® esiRNA

targeting human DNMT3B

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCCGACAGCTCTCCAATACTCAGGTTAATGCTGAAAAATCATCCAAGACAGTTATTGCAAGAGTTTAATTTTTGAAAACTGGCTACTGCTCTGTGTTTACAGACGTGTGCAGTTGTAGGCATGTAGCTACAGGACATTTTTAAGGGCCCAGGATCGTTTTTTCCCAGGGCAAGCAGAAGAGAAAATGTTGTATATGTCTTTTACCCGGCACATTCCCCTTGCCTAAATACAAGGGCTGGAGTCTGCACGGGACCTATTAGAGTATTTTCCACAATGATGATGATTTCAGCAGGGATGACGTCATCATCACATTCAGGGCTATTTTTTCCCCCACAAACCCAAGGGCAGGGGCCACTCTTAGCTAAATCCCTCCCCGTGACTGCAATAGAACCCTCTGGGGAGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Chelsea R McCoy et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 39(16), 3144-3158 (2019-01-27)
There is growing evidence of abnormal epigenetic processes playing a role in the neurobiology of psychiatric disorders, although the precise nature of these anomalies remains largely unknown. To study neurobiological (including epigenetic) factors that influence emotionality, we use rats bred
Hiroaki Fujimori et al.
Scientific reports, 5, 18231-18231 (2015-12-17)
A comprehensive genome-wide screen of radiosensitization targets in HeLa cells was performed using a shRNA-library/functional cluster analysis and DNMT3B was identified as a candidate target. DNMT3B RNAi increased the sensitivity of HeLa, A549 and HCT116 cells to both γ-irradiation and
Yue Zhou et al.
American journal of translational research, 11(3), 1736-1747 (2019-04-12)
Temporomandibular joint (TMJ) arthritis causes severe debilitation and has few treatment options. Here, we found a small molecule, DNA methyltransferase 3B (Dnmt3b), as a putative therapeutic target, partially rescued osteoarthritic phenotype. Dnmt3b was detected differentially expressed in cell zones of
Bo Wang et al.
BMC cancer, 18(1), 817-817 (2018-08-15)
Breast cancer is the most common malignancy in women worldwide. Although the endocrine therapy that targets estrogen receptor α (ERα) signaling has been well established as an effective adjuvant treatment for patients with ERα-positive breast cancers, long-term exposure may eventually
Yue Teng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 39(6), 2341-2352 (2016-11-11)
Epigenetic abnormalities are increasingly observed in multiple malignancies, including epithelial ovarian cancer (EOC), and their effects can be significantly counteracted by tumor-suppressor microRNAs, namely epi-miRNAs. Here, we investigated the role of miR-29b, a well-established epi-miRNA, in the DNA methylation regulation

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.