설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CATGAAAACTGTGGCAAACGATGTGCGATGCTTTCTTCTGTATTGGCTGCTCTCATTGGAATTGCAGGATCTGGCTACTGTGTCATTGTGGCAGCCCTTGGCTTAGCAGAAGGACCACTATGTCTTGATTCCCTCGGCCAGTGGAACTACACCTTTGCCAGCACTGAGGGCCAGTACCTTCTGGATACCTCCACATGGTCCGAGTGCACTGAACCCAAGCACATTGTGGAATGGAATGTATCTCTGTTTTCTATCCTCTTGGCTCTTGGTGGAATTGAATTCATCTTGTGTCTTATTCAAGTAATAAATGGAGTGCTTGGAGGCATATGTGGCTTTTGCTGCTCTCACCAACAGCAATATGACTGCTAAAAGAACCAACCCAGGACAGAGCCACAATCTTCC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TM4SF1(4071) , TM4SF1(4071)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Young Ran Park et al.
International journal of oncology, 48(5), 2135-2143 (2016-03-18)
Transmembrane-4-L6 family 1 (TM4SF1) is upregulated in colorectal carcinoma (CRC). However, the mechanism leading to inhibition of the TM4SF1 is not known. In the present study, we investigated the regulation of TM4SF1 and function of microRNAs (miRNAs) in CRC invasion
Yu-Cheng Su et al.
mAbs, 6(4), 1069-1083 (2014-05-31)
Modification of antibody class and binding properties typically requires cloning of antibody genes, antibody library construction, phage or yeast display and recombinant antibody expression. Here, we describe an alternative "cloning-free" approach to generate antibodies with altered antigen-binding and heavy chain
Yonghoon Kwon et al.
PloS one, 9(9), e108771-e108771 (2014-09-25)
5' AMP-activated protein kinase (AMPK) is a highly conserved serine-threonine kinase that regulates energy expenditure by activating catabolic metabolism and suppressing anabolic pathways to increase cellular energy levels. Therefore AMPK activators are considered to be drug targets for treatment of
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.