설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GATGAGTCTGCTCCCTCTGGCTCGATTTGCCGTTGCCTATTCTCCAGCCCGAGATGCAGGCAACAGAGAGATGCCCTCTCTACCCCGGGCAGGTCCTGAGGGCTCCACCAGACATGCAGCCAGCAAACAGAAATACCTGGAGAATTACCTCAACCGTCTCTTGACCATGTCTTTCTATCGCAACTACCATGCCATGACAGAGTTCCTGGAAGTCAGTCAGCTGTCCTTTATCCCGGACTTGGGCCGCAAAGGACTGGAGGGGATGATCCGGAAGCGCTCAGGTGGCCACCGTGTTCCTGGCCTCACCTGCTGTGGCCGAGACCAAGTTTGTTATCGCTGGTCCAAGAGGTGGCTGGTGGTGAAGGACTCCTTCCTGCTGTACATGTGCCTCGAGACAGGTGCCATCTCATTTGTTCAGCTCTTTGACCCTGG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... PLD2(5338) , PLD2(5338)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Raja-Elie E Abdulnour et al.
Journal of leukocyte biology, 103(5), 919-932 (2018-02-14)
Phospholipase D (PLD) plays important roles in cellular responses to tissue injury that are critical to acute inflammatory diseases, such as the acute respiratory distress syndrome (ARDS). We investigated the expression of PLD isoforms and related phospholipid phosphatases in patients
Chang Sup Lee et al.
BMB reports, 49(3), 191-196 (2016-01-29)
Vascular endothelial growth factor (VEGF) is a key mediator of angiogenesis and critical for normal embryonic development and repair of pathophysiological conditions in adults. Although phospholipase D (PLD) activity has been implicated in angiogenic processes, its role in VEGF signaling
Rochelle K Nelson et al.
Scientific reports, 7(1), 9112-9112 (2017-08-24)
The Phospholipase D (PLD) superfamily is linked to neurological disease, cancer, and fertility, and a recent report correlated a potential loss-of-function PLD2 polymorphism with hypotension. Surprisingly, PLD2 -/- mice exhibit elevated blood pressure accompanied by associated changes in cardiac performance
Xiaoyong Wang et al.
Molecular medicine reports, 16(2), 1964-1972 (2017-06-29)
Aquaporin 3 (AQP3) and phospholipase D2 (PLD2) are abnormally expressed and/or localized in squamous cell carcinoma (SCC). AQP3 transports glycerol to PLD2 for the synthesis of lipid second messenger, which can mediate the effect of the AQP3/PLD2 signaling module in
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.