콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU150481

Sigma-Aldrich

MISSION® esiRNA

targeting human EIF4EBP1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ATGGAGTGTCGGAACTCACCTGTGACCAAAACACCCCCAAGGGATCTGCCCACCATTCCGGGGGTCACCAGCCCTTCCAGTGATGAGCCCCCCATGGAAGCCAGCCAGAGCCACCTGCGCAATAGCCCAGAAGATAAGCGGGCGGGCGGTGAAGAGTCACAGTTTGAGATGGACATTTAAAGCACCAGCCATCGTGTGGAGCACTACCAAGGGGCCCCTCAGGGCCTTCCTGGGAGGAGTCCCACCAGCCAGGCCTTATGAAAGTGATCATACTGGGCAGGCGTTGGCGTGGGGTCGGACACCCCAGCCCTTTCTCCCTCACTCAGGGCACCTGCCCCCTCCTCTTCGTGAACACCAGCAGATACCTCCTTGTGCCTCCACTGATGCAGGAGCTGCCACCCCAAGGGGAGTGACCCCTGCCAGCACACCCTGCAGCCAAGGGCCAGGAAGTGGACAAGAACGAACCCTTC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Stabilization of 4E-BP1 by PI3K kinase and its involvement in CHK2 phosphorylation in the cellular response to radiation.
Zi-Jian Yu et al.
International journal of medical sciences, 14(5), 452-461 (2017-05-26)
Jin Young Sung et al.
Experimental gerontology, 109, 51-58 (2017-08-12)
Cellular senescence is related to aging and extremely stable proliferative arrest with active metabolism. Senescent cells can activate mammalian target of rapamycin (mTOR) pathway, which plays a crucial role in the regulation of cell metabolism, cellular growth, and autophagy in
Thomas Graillon et al.
Oncotarget, 8(33), 55361-55373 (2017-09-15)
Pasireotide is a somatostatin analog (SSA) that targets somatostatin receptor subtype 1 (SST1), SST2, SST3, and SST5 with a high affinity. Pasireotide has a better antisecretory effect in acromegaly, Cushing's disease, and neuroendocrine tumors than octreotide. In this study, we
Yuan-Chin Lee et al.
Cancer letters, 432, 191-204 (2018-06-19)
The present study aimed to investigate the pathway related to MCL1 expression in ABT-263-treated human leukemia U937 cells. ABT-263 upregulated MCL1 protein expression but did not affect its mRNA level and protein stability. Notably, ABT-263 increased 4EBP1 mRNA decay and thus
Lianhe Zheng et al.
Molecules and cells, 37(2), 118-125 (2014-03-07)
Osteosarcoma is the most common primary malignant bone tumor with a very poor prognosis. Treating osteosarcoma remains a challenge due to its high transitivity. Tenascin-C, with large molecular weight variants including different combinations of its alternative spliced FNIII repeats, is

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.