추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCTTGTGACCCAGCAGCTATCTAAGTCACAGGTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCTGGCTACGGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTGGCTGATGGGCCACAGGATGGCCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCTGACTGGCTCGAAGGCCATGGCATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATCCAGATGGACTCCCCAATGCTGCTGGCTGACCTGCCTGACCTCCAGGACCCCTGAGGCCCCCAGCCTGTGCCTTGCTGCCACAGTAGACCTAGTTCCAGGATCCATGGGAGCATTCTCAAAGGCTTTAGCCCTGGACCCAGCAGGTGAGGCTCGGCTTGGATTATTCTGCAGGTTCATCTCAGACCCACC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MAPK7(5598) , MAPK7(5598)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Yan Huang et al.
Tumori, 103(5), 483-488 (2016-10-30)
Osteosarcoma (OS) is the most common primary bone tumor and has low cure rates. Our study aimed to evaluate the roles of mitogen-activated protein kinase 7 (MAPK7) in cell proliferation, migration and invasion using the SOSP-M human OS cell line
Byambasuren Vanchin et al.
The Journal of pathology, 247(4), 456-470 (2018-12-20)
Endothelial-mesenchymal transition occurs during intimal hyperplasia and neointima formation via mechanisms that are incompletely understood. Endothelial MAPK7 signaling is a key mechanosensitive factor that protects against endothelial-mesenchymal transition, but its signaling activity is lost in vessel areas that are undergoing
Abrar Ul Haq Khan et al.
Scientific reports, 7(1), 10654-10654 (2017-09-08)
Controlling cholesterol levels is a major challenge in human health, since hypercholesterolemia can lead to serious cardiovascular disease. Drugs that target carbohydrate metabolism can also modify lipid metabolism and hence cholesterol plasma levels. In this sense, dichloroacetate (DCA), a pyruvate
Abrar Ul Haq Khan et al.
Scientific reports, 8(1), 7420-7420 (2018-05-11)
Oxidative phosphorylation (OXPHOS) generates ROS as a byproduct of mitochondrial complex I activity. ROS-detoxifying enzymes are made available through the activation of their antioxidant response elements (ARE) in their gene promoters. NRF2 binds to AREs and induces this anti-oxidant response.
Dae-Hwan Nam et al.
Molecules and cells, 40(7), 457-465 (2017-07-07)
Streptozotocin (STZ)-induced murine models of type 1 diabetes have been used to examine ER stress during pancreatic β-cell apoptosis, as this ER stress plays important roles in the pathogenesis and development of the disease. However, the mechanisms linking type 1
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.