설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTTGGACCATGAAGACCAGATTGCTTTGCTGAAAGGGTCTGCGGTTGAAGCTATGTTCCTTCGTTCAGCTGAGATTTTCAATAAGAAACTTCCGTCTGGGCATTCTGACCTATTGGAAGAAAGAATTCGAAATAGTGGTATCTCTGATGAATATATAACACCTATGTTTAGTTTTTATAAAAGTATTGGGGAACTGAAAATGACTCAAGAGGAGTATGCTCTGCTTACAGCAATTGTTATCCTGTCTCCAGATAGACAATACATAAAGGATAGAGAGGCAGTAGAGAAGCTTCAGGAGCCACTTCTTGATGTGCTACAAAAGTTGTGTAAGATTCACCAGCCTGAAAATCCTCAACACTTTGCCTGTCTCCTGGGTCGCCTGACTGAATTACGGACATTCAATCATCACCACGCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NR1H4(9971) , NR1H4(9971)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Ting Fu et al.
Molecular endocrinology (Baltimore, Md.), 30(1), 92-103 (2015-10-28)
The bile acid (BA)-sensing nuclear receptor, farnesoid X receptor (FXR), regulates postprandial metabolic responses, including inhibition of BA synthesis, by inducing the intestinal hormone, fibroblast growth factor (FGF)15 (FGF19 in human). In this study, we tested a novel hypothesis that
Dihydroartemisinin restricts hepatic stellate cell contraction via an FXR-S1PR2-dependent mechanism.
Wenxuan Xu et al.
IUBMB life, 68(5), 376-387 (2016-03-31)
Hepatic stellate cells (HSCs) are universally acknowledged to play a stimulative role in the pathogenesis of hepatic fibrosis and portal hypertension. HSCs when activated in response to liver injury are characterized with many changes, with HSC contraction being the most
Hai Hu et al.
Oncotarget, 8(20), 33265-33275 (2017-04-13)
Bile acids (BAs) was critical in the initiation and progression of various tumors. However, their prognostic significance in pancreatic cancer was still illusive. In the present study, the expression and biological significance of FXR, a major receptor of BAs, in
Wenxuan Xu et al.
Toxicology and applied pharmacology, 315, 23-34 (2016-12-13)
Alcoholic liver disease (ALD) is a common etiology of liver diseases, characterized by hepatic steatosis. We previously identified farnesoid X receptor (FXR) as a potential therapeutic target for ALD. Dihydroartemisinin (DHA) has been recently identified to possess potent pharmacological activities
Renchao Dong et al.
European journal of pharmacology, 857, 172461-172461 (2019-06-21)
Estrogen-induced cholestasis is a common etiology of hepatic diseases in women with contraceptives administration, pregnancy or hormone replacement therapy. Farnesoid X receptor (FXR) is a member of nuclear receptor super family of ligand-activated transcription factors that is highly expressed in
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.