설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CACAGAAACTGGGCCTGACTGAGGATCAGTTCATCAGGACCCCCACCGGGGACGAGTTTGTGAAGACCTCAGTGCGGAAGGGGCTGCTGCCCCAGATCCTGGAGAACCTGCTCAGTGCCCGGAAGAGGGCCAAGGCCGAGCTGGCCAAGGAGACAGACCCCCTCCGGCGCCAGGTCCTGGATGGACGGCAGCTGGCGCTGAAGGTGAGCGCCAACTCCGTATACGGCTTCACTGGCGCCCAGGTGGGCAAGTTGCCGTGCCTGGAGATCTCACAGAGCGTCACGGGGTTCGGACGTCAGATGATCGAGAAAACCAAGCAGCTGGTGGAGTCTAAGTACACAGTGGAGAATGGCTACAGCACCAGTGCCAAGGTGGTGTATGGTGACACTGACTCCGTCATGTGCCGATTCGGCGTGTCCTCGGTGGCTGAGGCGATGGCCCTGGGGCGGGAGGCCGCGGACTGGGTGTCAGGTCACT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... POLD1(5424) , POLD1(5424)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Qinghong Qin et al.
Oncology letters, 16(5), 5591-5598 (2018-10-23)
Polymerase δ catalytic subunit gene 1 (POLD1) may serve an important function in the development of tumors. However, its role in breast cancer remains unclear. The aim of the present study was to observe the expression and the function of
Albert Job et al.
Scientific reports, 10(1), 18924-18924 (2020-11-05)
Inhibition of the kinase ATR, a central regulator of the DNA damage response, eliminates subsets of cancer cells in certain tumors. As previously shown, this is at least partly attributable to synthetic lethal interactions between ATR and POLD1, the catalytic
Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.