설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ATATGGGAAAGATGCCACCAATGTGGGGGATGAAGGCGGGTTTGCTCCCAACATCCTGGAGAATAAAGAAGGCCTGGAGCTGCTGAAGACTGCTATTGGGAAAGCTGGCTACACTGATAAGGTGGTCATCGGCATGGACGTAGCGGCCTCCGAGTTCTTCAGGTCTGGGAAGTATGACCTGGACTTCAAGTCTCCCGATGACCCCAGCAGGTACATCTCGCCTGACCAGCTGGCTGACCTGTACAAGTCCTTCATCAAGGACTACCCAGTGGTGTCTATCGAAGATCCCTTTGACCAGGATGACTGGGGAGCTTGGCAGAAGTTCACAGCCAGTGCAGGAATCCAGGTAGTGGGGGATGATCTCACAGTGACCAACCCAAAGAGGATCGCCAAGGCCGTGAACGAGAAGTCCTGCAACTGCCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ENO1(2023) , ENO1(128178)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Hui Qiao et al.
Journal of cellular biochemistry, 120(11), 18714-18723 (2019-06-21)
Gastric cancer has become the third most common cancer around the world. In patients with gastric cancer, the 5-year survival rate is still low. However, the mechanism underlying gastric cancer remains largely unknown. As a glycolytic enzyme, enolase 1 (ENO1)
Xiaoling Qian et al.
Oncotarget, 8(29), 47691-47708 (2017-05-27)
Chemotherapy is the major choice for the cancer treatment of early and advanced stages. However, intrinsic or acquired drug resistance significantly restricts the clinical efficacy of chemotherapy. It is critical to develop novel approaches to detect and overcome drug resistance.
Yasmarie Santana-Rivera et al.
American journal of translational research, 12(4), 1275-1292 (2020-05-02)
Despite good responses to first-line treatment with platinum-based combination chemotherapy, most ovarian cancer patients will relapse and eventually develop a platinum-resistant disease with a poor overall prognosis. The molecular events leading to the cisplatin resistance of ovarian cancer cells are
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.