콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU116291

Sigma-Aldrich

MISSION® esiRNA

targeting human LGALS9

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CAGTGCTCAGAGGTTCCACATCAACCTGTGCTCTGGGAACCACATCGCCTTCCACCTGAACCCCCGTTTTGATGAGAATGCTGTGGTCCGCAACACCCAGATCGACAACTCCTGGGGGTCTGAGGAGCGAAGTCTGCCCCGAAAAATGCCCTTCGTCCGTGGCCAGAGCTTCTCAGTGTGGATCTTGTGTGAAGCTCACTGCCTCAAGGTGGCCGTGGATGGTCAGCACCTGTTTGAATACTACCATCGCCTGAGGAACCTGCCCACCATCAACAGACTGGAAGTGGGGGGCGACATCCAGCTGACCCATGTGCAGACATAGGCGGCTTCCTGGCCCTGGGGCCGGGGGCTGGGGTGTGGGGCAGTCTGGGTCCTCTCATCATCC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Katrin Schaefer et al.
Glycobiology, 27(9), 878-887 (2017-08-16)
Changes in the T cell surface redox environment regulate critical cell functions, such as cell migration, viral entry and cytokine production. Cell surface protein disulfide isomerase (PDI) contributes to the regulation of T cell surface redox status. Cell surface PDI
Tomokazu Nunoue et al.
Scientific reports, 11(1), 5991-5991 (2021-03-18)
The adipose tissue is regarded as an endocrine organ and secretes bioactive adipokines modulating chronic inflammation and oxidative stress in obesity. Gal-9 is secreted out upon cell injuries, interacts with T-cell immunoglobulin-3 (Tim-3) and induces apoptosis in activated Th1 cells.
Ran Lv et al.
Molecular medicine reports, 16(6), 9111-9119 (2017-10-11)
Generally considered as a potent pro‑inflammatory signal, β‑galactosidelectin suppresses T cell receptor activation, can both promote and inhibit integrin‑mediated adhesion and is required in nuclear pre‑mRNA splicing. Galectin‑9 (Gal‑9), a member of β‑galactoside lectin, is involved many processes of T cell‑mediated
Akira Nishio et al.
Hepatology (Baltimore, Md.), 65(1), 18-31 (2016-09-20)
Natural killer (NK) cell activation is associated with both liver injury and persistent infection in chronic hepatitis C (CHC); however, the detailed mechanism of this activation has not yet been fully elucidated. Because galectin-9 (Gal-9) has been reported to be
Wenxi Zhou et al.
Biomaterials, 268, 120546-120546 (2020-12-01)
Immunotherapy has gained increasing focus in treating pancreatic ductal adenocarcinoma (PDAC), since conventional therapies like chemotherapy could not provide satisfactory improvement in overall survival outcome of PDAC patients. However, it is still not the game changing solution due to the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.