설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TGGTAGCACCAGATGTCCAAATTGAAGATGGGAAAGGAACAATCCTAATATCTTCCGAAGAGGGAGAGACGGAAGCTAATAATCACAAGAAGTTGTCAGAATTTGGAATTAGAAATGGCAGCCGGCTTCAAGCAGATGACTTCCTCCAGGACTATACTTTATTGATCAACATCCTTCATAGTGAAGACCTAGGAAAGGACGTTGAATTTGAAGTTGTTGGTGATGCCCCGGAAAAAGTGGGGCCCAAACAAGCTGAAGATGCTGCCAAAAGCATAACCAATGGCAGTGATGATGGAGCTCAGCCCTCCACCTCCACAGCTCAAGAGCAAGATGACGTTCTCATAGTTGATTCAGATGAAGAAGATTCTTCAAATAATGCCGACGTCAGTGAAGAAGAGAGAAGCCGCAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... UBA2(10054) , UBA2(10054)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Biying Jiang et al.
Journal of cellular biochemistry, 120(8), 12752-12761 (2019-03-09)
Ubiquitin activating enzyme 2 (UBA2) is a basic component of E1-activating enzyme in the SUMOylation system. Expression and function of UBA2 in human cancers are largely unknown. In this study we investigate UBA2 expression the function in human non-small-cell lung
Xingyue He et al.
PloS one, 10(4), e0123882-e0123882 (2015-04-11)
SUMOylation is a post-translational ubiquitin-like protein modification pathway that regulates important cellular processes including chromosome structure, kinetochore function, chromosome segregation, nuclear and sub-nuclear organization, transcription and DNA damage repair. There is increasing evidence that the SUMO pathway is dysregulated in
Xiaoke Liu et al.
Journal of hematology & oncology, 8, 67-67 (2015-06-13)
SUMO-activating enzyme subunit 2 (SAE2) is the sole E1-activating enzyme required for numerous important protein SUMOylation, abnormal of which is associated with carcinogenesis. SAE2 inactivation was recently reported to be a therapeutic strategy in cancers with Myc overexpression. However, the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.