추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CACTAAGGCCAGACCCAAACTTTGATGCACTCATCAGCAAAATTTATCCAAGTCGTGATGAGTATGAAGCTCATCAAGAGAGAGTATTAGCCAGGATCAACAAGCACAATAATCAGCAAGCACTCAGTCACAGCATTGAGGAAGGACTGAAGATACAGGCCATGAACAGACTGCAGCGAGGCAAGAAACAACAGATTGAAAATGGTAGTGGAGCAGAAGATAATGGTGACAGTTCACACTGCAGTAATGCATCCACACATAGCAATCAGGAAGCAGGCCCTAGTAACAAACGGACCAAAACATCTGATGATTCTGGGCTAGAGCTTGATAATAACAATGCAGCAATGGCAATTGATCCAGTAATGGATGGTGCTAGTGAAATTGAATTAGTATTCAGGCCTCATCCCACACTTATGGAAAAAGATGACAGTGCACAGACGAGATACATAAAGACTTCTGGTAACGCCACTGTTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... RNF2(6045) , RNF2(6045)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Ring finger protein 2 promotes colorectal cancer progression by suppressing early growth response 1.
Feilong Wei et al.
Aging, 12(24), 26199-26220 (2020-12-22)
Ring finger protein 2 (RNF2) is an important component of polycomb repressive complex 1. RNF2 is upregulated in many kinds of tumors, and elevated RNF2 expression is associated with a poor prognosis in certain cancers. To assess the function of
Sen Zhu et al.
Nature communications, 9(1), 500-500 (2018-02-07)
BMI1, a polycomb group (PcG) protein, plays a critical role in epigenetic regulation of cell differentiation and proliferation, and cancer stem cell self-renewal. BMI1 is upregulated in multiple types of cancer, including prostate cancer. As a key component of polycomb
BAP1 immunohistochemistry and p16 FISH to separate benign from malignant mesothelial proliferations.
Brandon S Sheffield et al.
The American journal of surgical pathology, 39(7), 977-982 (2015-01-31)
A variety of immunohistochemical (IHC) stains have been proposed to mark either benign or malignant mesothelial proliferations. Loss of the p16 tumor suppressor (CDKN2A), through homozygous deletions of 9p21, is a good marker of mesotheliomas but lacks sensitivity. Recent reports
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.