콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU107461

Sigma-Aldrich

MISSION® esiRNA

targeting human RPS6KB1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CATCCCTTCATCGTGGATTTAATTTATGCCTTTCAGACTGGTGGAAAACTCTACCTCATCCTTGAGTATCTCAGTGGAGGAGAACTATTTATGCAGTTAGAAAGAGAGGGAATATTTATGGAAGACACTGCCTGCTTTTACTTGGCAGAAATCTCCATGGCTTTGGGGCATTTACATCAAAAGGGGATCATCTACAGAGACCTGAAGCCGGAGAATATCATGCTTAATCACCAAGGTCATGTGAAACTAACAGACTTTGGACTATGCAAAGAATCTATTCATGATGGAACAGTCACACACACATTTTGTGGAACAATAGAATACATGGCCCCTGAAATCTTGATGAGAAGTGGCCACAATCGTGCTGTGGATTGGTGGAGTTTGGGAGCATTAATGTATGACATGCTGACTGGAGCACCCCCATTCACTGGGGAGAATAGAAAGAAAACAATTGACAAAATCCTCAAATGTAAACTCAATTTGCCTCCCTACCTCACAC

Ensembl | 인체 수납 번호

ENSG00000108443

NCBI 수납 번호

NM_003161

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... RPS6KB1(6198) , RPS6KB1(6198)

관련 카테고리

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
CEV
QWU
JUU
EGS
DZR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Suleman S Hussain et al.
Cancer letters, 433, 232-241 (2018-07-14)
Radiation therapy (XRT) is a standard treatment for prostate cancer (PCa). Although dose escalation increases local control, toxicity hampers further escalation. Broader improvement will be possible by the addition of adjuvant therapies, which can synergize with radiation and thus improve
Subin Jin et al.
Journal of Korean medical science, 32(8), 1327-1336 (2017-07-01)
Microarray analysis was used to investigate the lack of identified mammalian target of rapamycin (mTOR) pathway downstream genes to overcome cross-talk at non-muscle invasive high-grade (HG)-urothelial carcinoma (UC) of the bladder, gene expression patterns, gene ontology, and gene clustering by
Tao Zhang et al.
International journal of molecular sciences, 15(2), 3154-3171 (2014-02-26)
The tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), either alone or in combination with other anti-cancer agents, has been considered as a new strategy for anti-cancer therapy. In this study, we demonstrated that evodiamine, a quinolone alkaloid isolated from the fruit
Ju Hyun Shin et al.
Scientific reports, 3, 1561-1561 (2013-03-28)
There is growing interest in identifying regulators of autophagy. The molecular mechanism underlying transforming growth factor-β activated kinase 1 (TAK1)-induced autophagy is poorly understood. We found that TAK1 inhibits p70 S6 kinase1 (S6K1) phosphorylation by interfering interaction of raptor with
Ye Wang et al.
International journal of radiation biology, 93(6), 581-589 (2017-03-10)
Ribosomal S6 kinase 1 (S6K1) plays an important role in cell proliferation, protein translation and cell survival. This study investigated the possibility of using S6K1 as a new target in the radiotherapy of non-small cell lung cancer (NSCLC) and its
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.