콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU099881

Sigma-Aldrich

MISSION® esiRNA

targeting human FN1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACACCTTCGGGGGAAATAATTCCTGTGAATATTCTTTTTCAATTCAGCAAACATTTGAAAATCTATGATGTGCAAGTCTAATTGTTGATTTCAGTACAAGATTTTCTAAATCAGTTGCTACAAAAACTGATTGGTTTTTGTCACTTCATCTCTTCACTAATGGAGATAGCTTTACACTTTCTGCTTTAATAGATTTAAGTGGACCCCAATATTTATTAAAATTGCTAGTTTACCGTTCAGAAGTATAATAGAAATAATCTTTAGTTGCTCTTTTCTAACCATTGTAATTCTTCCCTTCTTCCCTCCACCTTTC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Seth P Zimmerman et al.
Journal of cell science, 130(18), 2971-2983 (2017-07-30)
Rho GTPase family members are known regulators of directed migration and therefore play key roles in processes including development, the immune response and cancer metastasis. However, their individual contributions to these processes are complex. Here, we modify the activity of
Changgeng Xu et al.
Molecular medicine reports, 13(1), 901-908 (2015-12-10)
Lefty is a member of the transforming growth factor (TGF) β superfamily, which is implicated in left‑right patterning during embryogenesis. Previous studies revealed that lefty attenuates the epithelial‑mesenchymal transition in tubular epithelial cells. In the present study, the protective effect
Najla El-Hachem et al.
Cell death and differentiation, 25(11), 2010-2022 (2018-03-09)
HACE1 is an E3 ubiquitin ligase described as a tumour suppressor because HACE1-knockout mice develop multi-organ, late-onset cancers and because HACE1 expression is lost in several neoplasms, such as Wilms' tumours and colorectal cancer. However, a search of public databases
Wenzhong Yi et al.
Oncology reports, 36(6), 3145-3153 (2016-10-18)
Fibronectin is a glycoprotein of the extracellular matrix, and regulates the processes of self-renewal and cell cycle progression. This study aimed to investigate fibronectin expression in colorectal cancer (CRC) and elucidate the effects of fibronectin on CRC by using a
Fumiaki Sato et al.
Biological & pharmaceutical bulletin, 40(10), 1646-1653 (2017-10-03)
The cross-linking of elastin by lysyl oxidase (LOX) family members is essential for the integrity and elasticity of elastic fibers, which play an important role in the characteristic resilience of various tissues. However, the temporal sequence of oxidation by LOX

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.