설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGAACAGCCTCGATGTCAAACCCCTGCGCAAACCCCGTATCCCCATGGAGACCTTCAGAAAGGTGGGGATCCCCATCATCATAGCACTACTGAGCCTGGCGAGTATCATCATTGTGGTTGTCCTCATCAAGGTGATTCTGGATAAATACTACTTCCTCTGCGGGCAGCCTCTCCACTTCATCCCGAGGAAGCAGCTGTGTGACGGAGAGCTGGACTGTCCCTTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TMPRSS4(56649) , TMPRSS4(56649)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Cheng-Hao Wang et al.
Scientific reports, 5, 12366-12366 (2015-07-21)
TMPRSS4 (Transmembrane protease serine 4) is up-regulated in a broad spectrum of cancers. However, little is known about the biological effects of TMPRSS4 on hepatocellular carcinoma (HCC) and the related mechanisms. In the present study, we found that overexpression of
Dan Zhang et al.
Oncology reports, 35(1), 81-88 (2015-11-05)
Overexpression of transmembrane protease, serine 3 (TMPRSS3) has been detected in ovarian cancer. However, the molecular mechanisms of TMPRSS3 in ovarian cancer remain unclear. In the present study, we found that TMPRSS3 was significantly expressed in ovarian cancer cells. Overexpression
프로토콜
Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.