설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CGGTGAGAATGACTTCAGCATCATGTACTCAACCCGCAAGCGGAGTGCTCAGCTGTGGCTGGGCCCAGCCGCCTTCATCAACCATGACTGCAAACCCAACTGCAAGTTTGTGCCTGCAGATGGGAACGCAGCCTGCGTGAAGGTGCTCCGGGACATTGAGCCTGGGGACGAGGTGACATGCTTCTACGGCGAGGGCTTCTTCGGCGAGAAGAATGAGCACTGTGAATGCCACACCTGTGAGAGGAAAGGTGAAGGAGCTTTCCGAACCAGGCCTAGGGAGCCCGCGTTGCCACCACGGCCCCTGGACAAGTACCAGCTGCGTGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... KMT5C(84787) , SUV420H2(84787)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Farzaneh Khani et al.
Journal of cellular biochemistry, 118(5), 1262-1272 (2016-11-20)
Osteogenic lineage commitment and progression is controlled by multiple signaling pathways (e.g., WNT, BMP, FGF) that converge on bone-related transcription factors. Access of osteogenic transcription factors to chromatin is controlled by epigenetic regulators that generate post-translational modifications of histones ("histone
Satish Sati et al.
Molecular cell, 78(3), 522-538 (2020-03-30)
To understand the role of the extensive senescence-associated 3D genome reorganization, we generated genome-wide chromatin interaction maps, epigenome, replication-timing, whole-genome bisulfite sequencing, and gene expression profiles from cells entering replicative senescence (RS) or upon oncogene-induced senescence (OIS). We identify senescence-associated heterochromatin
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.