콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU096311

Sigma-Aldrich

MISSION® esiRNA

targeting human BRCA1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CTTCCCTGCTTCCAACACTTGTTATTTGGTAAAGTAAACAATATACCTTCTCAGTCTACTAGGCATAGCACCGTTGCTACCGAGTGTCTGTCTAAGAACACAGAGGAGAATTTATTATCATTGAAGAATAGCTTAAATGACTGCAGTAACCAGGTAATATTGGCAAAGGCATCTCAGGAACATCACCTTAGTGAGGAAACAAAATGTTCTGCTAGCTTGTTTTCTTCACAGTGCAGTGAATTGGAAGACTTGACTGCAAATACAAACACCCAGGATCCTTTCTTGATTGGTTCTTCCAAACAAATGAGGCATCAGTCTGAAAGCCAGGGAGTTG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Eliana Mc Tacconi et al.
EMBO molecular medicine, 9(10), 1398-1414 (2017-07-22)
Maintenance of genome integrity requires the functional interplay between Fanconi anemia (FA) and homologous recombination (HR) repair pathways. Endogenous acetaldehyde, a product of cellular metabolism, is a potent source of DNA damage, particularly toxic to cells and mice lacking the
Wenchao Ji et al.
Biochemical and biophysical research communications, 522(1), 121-126 (2019-11-23)
Lung cancer is the leading cause of cancer death worldwide. PARP inhibitors have become a new line of cancer therapy and a successful demonstration of the synthetic lethality concept. The mechanism and efficacy of PARP inhibitors have been well studied
Rikke D Rasmussen et al.
Nature communications, 7, 13398-13398 (2016-11-16)
Oncogene-evoked replication stress (RS) fuels genomic instability in diverse cancer types. Here we report that BRCA1, traditionally regarded a tumour suppressor, plays an unexpected tumour-promoting role in glioblastoma (GBM), safeguarding a protective response to supraphysiological RS levels. Higher BRCA1 positivity
Oreekha Amin et al.
BMC cancer, 15, 817-817 (2015-10-30)
Impairment of homologous recombination (HR) is found in close to 50 % of ovarian and breast cancer. Tumors with BRCA1 mutations show increased expression of the Insulin-like growth factor type 1 receptor (IGF-1R). We previously have shown that inhibition of
Nadire Duru et al.
Cancer letters, 369(1), 184-191 (2015-08-25)
Breast and lung cancer patients who are treated with radiotherapy often have severe side effects, including radiation-induced lung damage and secondary cancers. Activation of the NRF2 pathway is a well-known mechanism that protects cells against radiation induced oxidative stress, but

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.