설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TATTCCCGAGGTTTCACAGGTGAAGATGAGGATATGGCCTTCCCTGGGCACTTGTATGATGAGGTAGAAAGAACGTACCCCCCGTCTGGAGCCTGGGGACCCCTCTACGATGAAGTGCAGATGGGACCCTGGGACCTCCACTGGCCTGAAGACACATATCAGGATCCAAGAGGAATCTATGACCAGGTGGCCGGAGACTTGGACACTCTGGAACCCGATTCTCTGCCCTTCGAGCTGAGGGGACATCTGGTGTAAGAGCCCTCTCAACCCCATTGTCCTGCACCTGCAGGAATTTACACTCCACTGGTCTCTCTCATTACAGCCTGGGCCGAGCTGGTTAGGTGAGCTCCATAAAACCCA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NPHS1(4868) , NPHS1(4868)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Hossein Tezval et al.
BMC cancer, 13, 199-199 (2013-04-24)
Significance of Urocortin (Ucn or UcnI), Ucn2, Ucn3 and their receptors, Corticotropin Releasing Factor Receptor 1 and 2 (CRFR1 and CRFR2), and the binding protein, Corticotropin-Releasing Hormone-Binding Protein (CRHBP) in oncology is growing rapidly. The objective of our study was
Jiyoun Lee et al.
Scientific reports, 7(1), 12346-12346 (2017-09-29)
Hypertrophy is a prominent feature of damaged podocytes in diabetic kidney disease (DKD). mTORC1 hyperactivation leads to podocyte hypertrophy, but the detailed mechanism of how mTORC1 activation occurs under pathological conditions is not completely known. Moreover, reduced nephrin tyrosine phosphorylation
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.