콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU088381

Sigma-Aldrich

MISSION® esiRNA

targeting human EGLN1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AGCTGGCGCTCGAGTACATCGTGCCGTGCATGAACAAGCACGGCATCTGTGTGGTGGACGACTTCCTCGGCAAGGAGACCGGACAGCAGATCGGCGACGAGGTGCGCGCCCTGCACGACACCGGGAAGTTCACGGACGGGCAGCTGGTCAGCCAGAAGAGTGACTCGTCCAAGGACATCCGAGGCGATAAGATCACCTGGATCGAGGGCAAGGAGCCCGGCTGCGAAACCATTGGGCTGCTCATGAGCAGCATGGACGACCTGATACGCCACTGTAACGGGAAGCTGGGCAGCTACAAAATCAATGGCCGGACGAAAGCCATGGTTGCTTGTTATCCGGGCAATGGAACGGGTTATGTACGTCATGTTGATAATCCAAATGGAGATGGAAGATGTGTGAC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Junping Hu et al.
Scientific reports, 7(1), 15878-15878 (2017-11-22)
Proteinuria is closely associated with the progression of chronic kidney diseases (CKD) by producing renal tubulointerstitial fibrosis. Over-activation of hypoxia inducible factor (HIF)-1α has been implicated in the progression of CKD. The present study tested the hypothesis that HIF-1α mediates
Hyo Jeong Yong et al.
Oncotarget, 8(41), 69833-69846 (2017-10-21)
Hypoxia-induced interleukin-32β (IL-32β) shifts the metabolic program to the enhanced glycolytic pathway. In the present study, the underlying mechanism by which hypoxia-induced IL-32β stability is regulated was investigated in ovarian cancer cells. IL-32β expression increased under hypoxic conditions in ovarian
Kai Zhu et al.
International journal of nanomedicine, 9, 5203-5215 (2014-11-28)
Mesenchymal stem cell (MSC) transplantation has attracted much attention in myocardial infarction therapy. One of the limitations is the poor survival of grafted cells in the ischemic microenvironment. Small interfering RNA-mediated prolyl hydroxylase domain protein 2 (PHD2) silencing in MSCs

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.