추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCAGATGCAGTGCTTCAAAAGCCACAACCCCAGTTATACAGACCTATAGAAGAGACACCATGCCATTTCATATCCTCCCTGGATGAACTCGTGGAACTCAACGAAAAGCTCTTGAATTGTCAGGAATTTGCAGTTGACTTGGAGCACCACTCTTACAGGAGCTTCCTGGGACTGACCTGCCTGATGCAAATTTCTACTCGGACGGAAGACTTCATCATTGACACCCTCGAGCTTCGAAGTGACATGTACATTCTCAATGAGAGCCTCACAGACCCAGCCATCGTTAAGGTCTTTCATGGTGCTGATTCAGACATAGAATGGCTACAGAAAGACTTTGGGTTGTATGTAGTAAACATGTTTGATACTCATCAGGCAGCACGCCTTCTTAACCTGGGCAGGCACT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... EXOSC10(5394) , EXOSC10(5394)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Lee Davidson et al.
Cell reports, 26(10), 2779-2791 (2019-03-07)
Cell-based studies of human ribonucleases traditionally rely on methods that deplete proteins slowly. We engineered cells in which the 3'→5' exoribonucleases of the exosome complex, DIS3 and EXOSC10, can be rapidly eliminated to assess their immediate roles in nuclear RNA biology.
Penelope Kroustallaki et al.
Cell reports, 28(7), 1690-1702 (2019-08-15)
Telomerase biogenesis is a complex process where several steps remain poorly understood. Single-strand-selective uracil-DNA glycosylase (SMUG1) associates with the DKC1-containing H/ACA ribonucleoprotein complex, which is essential for telomerase biogenesis. Herein, we show that SMUG1 interacts with the telomeric RNA component
Karla Rubio et al.
Nature communications, 10(1), 2229-2229 (2019-05-22)
Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and highly lethal lung disease with unknown etiology and poor prognosis. IPF patients die within 2 years after diagnosis mostly due to respiratory failure. Current treatments against IPF aim to ameliorate patient
Dan Vershkov et al.
Cell reports, 26(10), 2531-2539 (2019-03-07)
Fragile X syndrome (FXS) is caused primarily by a CGG repeat expansion in the FMR1 gene that triggers its transcriptional silencing. In order to investigate the regulatory layers involved in FMR1 inactivation, we tested a collection of chromatin modulators for
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.