콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU081751

Sigma-Aldrich

MISSION® esiRNA

targeting human DNM1L

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TTTTTCACCCAACGTTGTCAATTTGACACTTGTGGATTTGCCAGGAATGACCAAGGTGCCTGTAGGTGATCAACCTAAGGATATTGAGCTTCAAATCAGAGAGCTCATTCTTCGGTTCATCAGTAATCCTAATTCCATTATCCTCGCTGTCACTGCTGCTAATACAGATATGGCAACATCAGAGGCACTTAAAATTTCAAGAGAGGTAGATCCAGATGGTCGCAGAACCCTAGCTGTAATCACTAAACTTGATCTCATGGATGCGGGTACTGATGCCATGGATGTATTGATGGGAAGGGTTATTCCAGTCAAACTTGGAATAATTGGAGTAGTTAACAGGAGCCAGCTAGATATTAACAACAAGAAGAGTGTAACTGATTCAATCCGTGATGAGTATGCTTTTCTTCAAAAGAAATATCCATCTCTGGCCAATAGAAA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Unbin Chae et al.
Bioscience, biotechnology, and biochemistry, 83(3), 409-416 (2018-11-27)
Microglial activation is known to be an important event during innate immunity, but microglial inflammation is also thought to play a role in the etiology of neurodegenerative diseases. Recently, it was reported that autophagy could influence inflammation and activation of
Maria Manczak et al.
Human molecular genetics, 28(2), 177-199 (2018-09-22)
The purpose of our study was to better understand the effects of mitochondrial-division inhibitor 1 (Mdivi-1) on mitochondrial fission, mitochondrial biogenesis, electron transport activities and cellular protection. In recent years, researchers have found excessive mitochondrial fragmentation and reduced fusion in
S Xu et al.
Cell death & disease, 4, e540-e540 (2013-03-16)
Mitochondria are critical targets in the hepatotoxicity of cadmium (Cd). Abnormal mitochondrial dynamics have been increasingly implicated in mitochondrial dysfunction in pathophysiological conditions. Therefore, our study aimed to investigate the effects and underlying mechanism of Cd on mitochondrial dynamics during
Dongjoon Kim et al.
Cells, 9(7) (2020-07-16)
Diabetic retinopathy is a prevalent microvascular complication characterized by apoptotic vascular cell loss in the retina. Previous studies have shown that high glucose (HG)-induced mitochondrial fragmentation plays a critical role in promoting retinal vascular cell apoptosis. Here, we investigated whether
Chun Guo et al.
Scientific reports, 7, 43811-43811 (2017-03-07)
The GTPase dynamin-related protein 1 (Drp1) is essential for physiological and pathophysiological mitochondrial fission. DeSUMOylation of Drp1 by the enzyme SENP3 promotes cell death during reperfusion after ischaemia by enhancing Drp1 partitioning to the mitochondrial outer membrane (MOM), which causes

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.