콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU058421

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL2L2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGACAAGTGCAGGAGTGGATGGTGGCCTACCTGGAGACGCAGCTGGCTGACTGGATCCACAGCAGTGGGGGCTGGGCGGAGTTCACAGCTCTATACGGGGACGGGGCCCTGGAGGAGGCGCGGCGTCTGCGGGAGGGGAACTGGGCATCAGTGAGGACAGTGCTGACGGGGGCCGTGGCACTGGGGGCCCTGGTAACTGTAGGGGCCTTTTTTGCTAGCAAGTGAAAGTCCAGGGCCAGGTGGGGCTAGGTGTGGCTGGGGGCCAGGAGAGCAGGAACAGAACAGAGAAATGCCCTTGGAAGAAGTGGAGTTGGTGGATGGGTGGGCATGGAACAGGATGGGCAGAGAAAGGGTAGTGTGTGAGGGAGCTGAGTAGGCCAGGTAGGCGATTGGAAGAGTGAGCAGGACACAGAGGGGAGGGGAATGTTTTGGCAAGTTTAGGGG

Ensembl | 인체 수납 번호

ENSG00000129473

NCBI 수납 번호

NM_004050

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... BCL2L2(599) , BCL2L2(599)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
DOR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Clare M Adams et al.
The Journal of clinical investigation, 127(2), 635-650 (2017-01-18)
Compromised apoptotic signaling is a prerequisite for tumorigenesis. The design of effective therapies for cancer treatment depends on a comprehensive understanding of the mechanisms that govern cell survival. The antiapoptotic proteins of the BCL-2 family are key regulators of cell
L Fang et al.
European review for medical and pharmacological sciences, 21(13), 3069-3074 (2017-07-26)
Lung cancer seriously threats to patient's life and health. Cyramza is a therapeutic drug for inhibition of vessel formation and growth in clinical practice. The aim of this study was to investigate the effect of cyramza on growth and apoptosis
Si-Hong Liu et al.
International journal of biological sciences, 16(6), 935-946 (2020-03-07)
Lymphoma is a malignant disease of the hematopoietic system that typically affects B cells. The up-regulation of miR-148b is associated with radiosensitization in B-cell lymphoma (BCL). This study aimed to explore the role of miR-148b in regulating the radiosensitivity of
Hyun Joo Chung et al.
Oncotarget, 6(21), 18429-18444 (2015-07-15)
Glioblastoma multiforme (GBM) is the most common malignant brain tumor and exhibits aggressive and invasive behavior. We previously identified four miRNAs-miR-29b, 494, 193a-3p, and 30e-with enhanced expression in GBM following treatment of ionizing radiation by miRNA microarray analysis. In this

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.