콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU026401

Sigma-Aldrich

MISSION® esiRNA

targeting human STIM1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AGGCAGTCCGTAACATCCACAAACTGATGGACGATGATGCCAATGGTGATGTGGATGTGGAAGAAAGTGATGAGTTCCTGAGGGAAGACCTCAATTACCATGACCCAACAGTGAAACACAGCACCTTCCATGGTGAGGATAAGCTCATCAGCGTGGAGGACCTGTGGAAGGCATGGAAGTCATCAGAAGTATACAATTGGACCGTGGATGAGGTGGTACAGTGGCTGATCACATATGTGGAGCTGCCTCAGTATGAGGAGACCTTCCGGAAGCTGCAGCTCAGTGGCCATGCCATGCCAAGGCTGGCTGTCACCAACACCACCATGACAGGGACTGTGCTGAAGATGACAGACCGGAGTCATCGGCAGAAGCTGCAGCTGAAGGCTCTGGATACAGTGCTCTTTGGGCCTCCTCTCTT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Dongyu Wei et al.
Frontiers in cellular neuroscience, 11, 400-400 (2018-01-10)
Store-operated calcium channels (SOCs) are highly calcium-selective channels that mediate calcium entry in various cell types. We have previously reported that intraplantar injection of YM-58483 (a SOC inhibitor) attenuates chronic pain. A previous study has reported that the function of
Yan-Yang Mao et al.
Biochemical and biophysical research communications, 505(1), 119-125 (2018-09-23)
The prevention and treatment of coronary heart disease (CHD) is a difficult problem to be solved. More and more studies have found that circular RNAs (circRNAs) may play important roles in the development of CHD. Here detection of vascular smooth
Yadong Wang et al.
Oncotarget, 7(52), 86584-86593 (2016-11-20)
This study aimed to address the potential role of STIM1 (stromal interaction molecule 1) in lung tumorigenesis. Colony formation in soft agar assay and tumorigenicity in nude mice assay were conducted. Western blot, immunohistochemistry and quantitative real-time polymerase chain reaction
Ping Li et al.
Cell calcium, 71, 45-52 (2018-04-02)
Bone resorption is mainly mediated by osteoclasts (OCs), whose formation and function are regulated by intracellular Ca2+ oscillation. Our previous studies demonstrated that fluid shear stress (FSS) lead to Ca2+ oscillation through mechanosensitive cation-selective channels. However, the specific channels responsible
Ping Li et al.
PloS one, 12(5), e0177484-e0177484 (2017-05-12)
Calcium signal plays an important role in a variety of cancer cell metabolism, but knowledge on its role in head and neck squamous cell carcinoma (HNSCC) is limited. Store-operated calcium entry (SOCE) is the principal Ca2+ entry mechanism that maintains

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.