추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTCAGGGAAAAGCATTCGTCAAAGAGAGCTTAAAATGCATCGCCAACGGGGTCACCTCCAAGGTCTTCCTCGCCATTCGGAGGTGCTCCACTTTCCAAAGGATGATTGCTGAGGTGCAGGAAGAGTGCTACAGCAAGCTGAATGTGTGCAGCATCGCCAAGCGGAACCCTGAAGCCATCACTGAGGTCGTCCAGCTGCCCAATCACTTCTCCAACAGATACTATAACAGACTTGTCCGAAGCCTGCTGGAATGTGATGAAGACACAGTCAGCACAATCAGAGACAGCCTGATGGAGAAAATTGGGCCTAACATGGCCAGCCTCTTCCACATCCTGCAGACAGACCACTGTGCCCAAACACACCCACGAGCTGACTTCAACAGGAGACGCACCAATGAGCCGCAGAAGCTGAAAGTCCTCCTCAGGAACCTCCGAGGTGAGGAGGACTCTCCCTCCCACATCAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... STC1(6781) , STC1(6781)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Dong Dai et al.
Oncology reports, 35(1), 552-558 (2015-11-05)
The new anti-aging gene Klotho has been identified as a multi-functional humoral factor which influences multiple biological processes, including tumor progression. Although ample evidence indicates that Klotho plays important roles in cervical, lung and breast cancer, the role and mechanism
Wenru Su et al.
Journal of molecular cell biology, 9(4), 289-301 (2017-06-29)
Mesenchymal stem cells (MSCs) have been demonstrated to have promising therapeutic benefits for a variety of neurological diseases; however, the underlying mechanisms are poorly understood. Here, we showed that intravitreal infusion of MSCs promoted retinal ganglion cell (RGC) survival in
Huai-Bin Hu et al.
Nature communications, 12(1), 662-662 (2021-01-30)
Dynamic assembly and disassembly of primary cilia controls embryonic development and tissue homeostasis. Dysregulation of ciliogenesis causes human developmental diseases termed ciliopathies. Cell-intrinsic regulatory mechanisms of cilia disassembly have been well-studied. The extracellular cues controlling cilia disassembly remain elusive, however.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.