콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU019541

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR3

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACTTAGCACGGCTCTGGAAACACGCAAACCCTGGTGGTCCCATTTATTTCCTAAAGGGTCTGTCTCACCTCCACATCCTTAACTTGGAGTCCAACGGCTTTGACGAGATCCCAGTTGAGGTCTTCAAGGATTTATTTGAACTAAAGATCATCGATTTAGGATTGAATAATTTAAACACACTTCCAGCATCTGTCTTTAATAATCAGGTGTCTCTAAAGTCATTGAACCTTCAGAAGAATCTCATAACATCCGTTGAGAAGAAGGTTTTCGGGCCAGCTTTCAGGAACCTGACTGAGTTAGATATGCGCTTTAATCCCTTTGATTGCACGTGTGAAAGTATTGCCTGGTTTGTTAATTGGATTAACGAGACCCATACCAACATCCCTGAGCTGTCAAGCCACTACCTTTGCAACACTCCACCTCA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xiaoxiao Yu et al.
Cell journal, 22(3), 325-333 (2019-12-22)
This study aimed to evaluate the specific roles of polyinosinic:polycytidylic acid (polyI:C) in macrophage chemotaxis and reveal the potential regulatory mechanisms related to chemokine receptor 5 (CCR5). In this experimental study, THP-1-derived macrophages (THP1-Mφs) induced from THP- 1 monocytes were
Radhashree Maitra et al.
Oncotarget, 8(21), 35138-35153 (2017-04-20)
New therapeutic interventions are essential for improved management of patients with metastatic colorectal cancer (mCRC). This is especially critical for those patients whose tumors harbor a mutation in the KRAS oncogene (40-45% of all patients). This patient cohort is excluded
Maya O Tree et al.
Virology, 497, 81-91 (2016-07-20)
Arboviruses are a large group of viruses that are transmitted by arthropods including ticks and mosquitoes. The global diversity of arboviruses is unknown; however, theoretical studies have estimated that over 2,000 mosquito-borne flaviviruses may exist. An increasing number of flaviviruses
Ye Liu et al.
Journal of cellular biochemistry, 120(6), 9532-9538 (2018-12-07)
To investigate the effect and mechanism of microRNA-186-5p (miR-186-5p) on the apoptosis in high glucose (HG)-treated cardiomyocytes. Diabetic cardiomyopathy model was established in cardiomyocytes by stimulating with HG. The expressions of miR-186-5p and toll-like receptor 3 (TLR3) were detected by
Zengguang Xu et al.
Cancer cell international, 14, 80-80 (2014-01-01)
Therapeutic options for patients with non-small cell lung cancer (NSCLC) are often restricted to systemic chemotherapy. However, the molecular and cellular processes during chemotherapy of advanced NSCLC patients still remain unclear. Here we investigated the stimulatory activity of plasma in

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.