추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GAGCCTGAGGCCGACTACTACGCCAAGGAGGTCACCCGCGTGCTAATGGTGGAAACCCACAACGAAATCTATGACAAGTTCAAGCAGAGTACACACAGCATATATATGTTCTTCAACACATCAGAGCTCCGAGAAGCGGTACCTGAACCCGTGTTGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTCAAGTTAAAAGTGGAGCAGCACGTGGAGCTGTACCAGAAATACAGCAACAATTCCTGGCGATACCTCAGCAACCGGCTGCTGGCACCCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTCACCGGAGTTGTGCGGCAGTGGTTGAGCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGCGCCCACTGCTCCTGTGACAGCAGGGATAACACACTGCAAGTGGACATCAACGGGTTC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TGFB1(7040) , TGFB1(7040)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Satomi Furukawa et al.
Experimental cell research, 383(1), 111506-111506 (2019-07-22)
NOD-like receptor family, pyrin domain-containing 3 (NLRP3) is one of the key components of the inflammasome. NLRP3 also participates in the regulation of fibrosis independent of the inflammasome. In this study, we analyzed the mechanism of upregulation of NLRP3 expression
Danae E Zamboulis et al.
eLife, 9 (2020-10-17)
Mature connective tissues demonstrate highly specialised properties, remarkably adapted to meet their functional requirements. Tissue adaptation to environmental cues can occur throughout life and poor adaptation commonly results in injury. However, the temporal nature and drivers of functional adaptation remain
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.