콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

모든 문서 보기

EHU010131

Sigma-Aldrich

MISSION® esiRNA

targeting human ZEB2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGGACAGATCAGCACCAAATGCTAACCCAAGGAGCAGGTAATCGCAAGTTCAAATGCACAGAGTGTGGCAAGGCCTTCAAATATAAACACCATCTGAAAGAACACCTGCGAATTCACAGTGGTGAAAAACCTTACGAGTGCCCAAACTGCAAGAAACGTTTCTCCCATTCTGGTTCCTACAGTTCGCACATCAGCAGCAAGAAATGTATTGGTTTAATCTCTGTAAATGGCCGAATGAGAAACAATATCAAGACGGGTTCTTCCCCTAATTCTGTTTCTTCTTCTCCTACTAATTCAGCCATTACCCAGTTAAGAAACAAGTTGGAGAATGGAAAACCACTTAGTATGTCTGAACAGACAGGCTTACTTAAAATTAAAACAGAACCACTAGACTTCAATGACTATAAAGTTCTTATGGCTACACACGGGTTTAGTGGCACTAGTCCCTTTATGAATGGTGGGCTTGGAGCCACCAGCCCTTTAGGAGTTCATCCATCTGCTCAGAGTCCAATGCAGCACTTAGGTG

Ensembl | 인체 수납 번호

ENSG00000169554

NCBI 수납 번호

NM_014795

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ZEB2(9839) , ZEB2(9839)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
HQS
XHS
TVR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Loukia N Lili et al.
Cancer letters, 428, 184-191 (2018-05-08)
Expression levels of the miR-200 family of miRNAs are significantly reduced during the epithelial-to-mesenchymal transition (EMT) and consequent metastasis of ovarian and other cancers. Consistently, ectopic over-expression of miR-200 family miRNAs in mesenchymal-like cells reverses the process by converting treated
Tao Jiang et al.
Oncology reports, 38(1), 151-158 (2017-05-24)
This study was specifically designed to confirm the hypothesis that microRNA-200c (miR-200c) affects the development of cisplatin (DDP) resistance in human gastric cancer cells by targeting zinc finger E-box binding homeobox 2 (ZEB2). A total of 50 gastric cancer tissues and
D-M Geng et al.
European review for medical and pharmacological sciences, 21(8), 1746-1752 (2017-05-10)
To investigate the effect of ZEB2 silencing on cisplatin resistance in gastric cancer. The resulting cell line, SGC7901/DDP, was transfected with ZEB2 siRNA, non-specific siRNA, or vehicle control. The effectiveness of ZEB2 silencing was evaluated by reverse transcriptase-polymerase chain reaction
Steven Goossens et al.
Blood, 129(8), 981-990 (2017-01-11)
Elevated expression of the Zinc finger E-box binding homeobox transcription factor-2 (ZEB2) is correlated with poor prognosis and patient outcome in a variety of human cancer subtypes. Using a conditional gain-of-function mouse model, we recently demonstrated that ZEB2 is an
Sanchari Roy et al.
Clinical science (London, England : 1979), 130(14), 1197-1207 (2016-04-30)
miR-192-5p has gained increasing relevance in various diseases, however, its function in acute liver injury is currently unknown. We analysed miR-192-5p serum levels and hepatic miR-192-5p expression in mice after hepatic ischaemia and reperfusion (I/R) as well as in toxic
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.