추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAATTCCAGGGGAAGTGGTATGTGGTAGGCCTGGCAGGGAATGCAATTCTCAGAGAAGACAAAGACCCGCAAAAGATGTATGCCACCATCTATGAGCTGAAAGAAGACAAGAGCTACAATGTCACCTCCGTCCTGTTTAGGAAAAAGAAGTGTGACTACTGGATCAGGACTTTTGTTCCAGGTTGCCAGCCCGGCGAGTTCACGCTGGGCAACATTAAGAGTTACCCTGGATTAACGAGTTACCTCGTCCGAGTGGTGAGCACCAACTACAACCAGCATGCTATGGTGTTCTTCAAGAAAGTTTCTCAAAACAGGGAGTACTTCAAGATCACCCTCTACGGGAGAACCAAGGAGCTGACTTCGGAACTAAAGGAGAACTTCATCCGCTTCTCCAAATCTCTGGGCCTCCCTGAAAACCACATCGTCTTCCCTGTC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... LCN2(3934) , LCN2(3934)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Se-Lim Kim et al.
Cancer science, 108(11), 2176-2186 (2017-09-01)
Lipocalin 2 (LCN2), a member of the lipocalin superfamily, plays an important role in oncogenesis and progression in various types of cancer. However, the expression pattern and functional role of LCN2 in colorectal cancer (CRC) is still poorly understood. The
Masafumi Okuda et al.
Oncotarget, 8(21), 34670-34677 (2017-04-15)
Esophageal cancer is the eighth most common cancer and the sixth most common cause of cancer-related deaths worldwide. Despite the research progress in understanding the disease, the mechanism underlying the metastasis is still unclear. Here, we successfully generated a highly
Bilge Ören et al.
The Journal of pathology, 239(3), 274-285 (2016-04-03)
Tumour cell-secreted factors skew infiltrating immune cells towards a tumour-supporting phenotype, expressing pro-tumourigenic mediators. However, the influence of lipocalin-2 (Lcn2) on the metastatic cascade in the tumour micro-environment is still not clearly defined. Here, we explored the role of stroma-derived
Peng Guo et al.
Theranostics, 6(1), 1-13 (2016-01-02)
Lipocalin 2 (Lcn2) is a promising therapeutic target as well as a potential diagnostic biomarker for breast cancer. It has been previously shown to promote breast cancer progression by inducing the epithelial to mesenchymal transition in breast cancer cells as
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.