콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU001951

Sigma-Aldrich

MISSION® esiRNA

targeting human REL

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCCCATCTCAAGTGGATTGTCACATCATGCCTCAATGGCACCTCTGCCTTCTTCAAGCTGGTCATCAGTGGCCCACCCCACCCCACGCTCAGGCAATACAAACCCACTGAGTAGTTTTTCAACAAGGACACTTCCTTCTAATTCGCAAGGTATCCCACCATTCCTGAGAATACCTGTTGGGAATGATTTAAATGCTTCTAATGCTTGCATTTACAACAATGCCGATGACATAGTCGGAATGGAAGCGTCATCCATGCCATCAGCAGATTTATATGGTATTTCTGATCCCAACATGCTGTCTAATTGTTCTGTGAATATGATGACAACCAGCAGTGACAGCATGGGAGAGACTGATAATCCAAGACTTCTGAGCATGAATCTTGAAAACCCCTCATGTAATTCAGTGTTAGACCCAAGAGACTTGAGACAGCTCCATCAGATGTCCTCTTCCAGTATGTCAGCAGGCGCCAATTCCAATACTACTGTTTTTGTTTCACAATCAGATGCATTTGAGGGATCTGACTTCAGTTGTGCAGATAACAGCATGATAAATGAGTCGGGACCATCAA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Xiaodong Lai et al.
Oncology reports, 36(6), 3651-3656 (2016-10-26)
miR‑574‑5p has been reported involved in the pathogenesis of numerous human malignancies such as colorectal and lung cancer. In this study, we aimed to explore the roles of REL and miR‑574 in the recurrence of prostate cancer (PCa) and to identify
Seyedeh Momeneh Mohammadi et al.
Leukemia research, 61, 53-61 (2017-09-12)
The c-Rel transcription factor is a unique member of the NF-kB family that has a role in apoptosis, proliferation and cell survival. Overexpression of c-Rel is detected in many human B cell tumors, including B-cell leukemia and several cancers. The
Shayna E Thomas-Jardin et al.
The Prostate, 80(2), 133-145 (2019-11-16)
The androgen receptor (AR) nuclear transcription factor is a therapeutic target for prostate cancer (PCa). Unfortunately, patients can develop resistance to AR-targeted therapies and progress to lethal disease, underscoring the importance of understanding the molecular mechanisms that underlie treatment resistance.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.